Complete Works (Português & English)

•CHARiAsrrr.mi

7 M Al)>tn'^r

$

f

CONTENTS

1.

Star Stones

1

2.

Fate Has Twelve Stations

19

3.

Divine Generations

40

4.

Between Fate and Destiny

61

5.

Of Death and Resurrection

83

6.

The Cosmic Connection: DNA

105

7.

Secret Knowledge, Sacred Texts

125

8.

Hidden Codes, Mystic Numbers

152

9.

Prophecy: Writings from the Past

178

10.

Navel of the Earth

198

11.

A Time of Prophecy

232

12.

The God Who Returned

from Heaven

260

Epilogue

277

Index

283

STAR STONES

It took a war — a fierce and bloody war — to bring to light,
just decades ago, one of the most enigmatic ancient sites in
the Near East. If not the most enigmatic, it certainly is the
most puzzling, and for sure one rooted in great antiquity. It
is a structure that has no parallel among the remains of the
great civilizations that had flourished in the Near East in past
millennia — at least so far as has been uncovered. Its closest
parallels are thousands of miles away, across the seas and on
other continents; and what it mostly brings to mind is Stone-
henge in faraway Britain.

There, on a windswept plain in England about eighty miles
southwest of London, circles of imposing megaliths form the
most important prehistoric monument in the whole of Britain.
There, a semicircle of huge upright stones that have been
connected at their tops by lintel stones encompasses within
it a semicircle of smaller stone uprights, and is surrounded
in turn by two circles of other megaliths. The multitudes that
visit the site find that only some of the megaliths still remain
standing, while others have collapsed to the ground or are
somehow gone from the site. But scholars and researchers
have been able to figure out the configuration of the circles-
wi thin-circles (Fig. 1, which highlights the still-standing
megaliths), and observe the holes indicating where two other
circles — of stones or perhaps wooden pegs — had once ex-
isted, in earlier phases of Stonehenge.

The horseshoe semicircles, and a fallen large megalith
nicknamed the Slaughter Stone, indicate beyond doubt that
the structure was oriented on a northeast-southwest axis.

1

THE COSMIC CODE

* m ~ " m ^A ^

jA Ml ^ -

^v— — *1<?

Figure I

They point to a line of sight that passes between two stone
uprights through a long earthworks Avenue, straight to the
so-called Heel Stone (Fig. 2). All the studies conclude that
the alignments served astronomical purposes; they were first
oriented circa 2900 B.C. (give or take a century or so) to
sunrise on the summer solstice day; and then realigned circa
2000 B.C. and again circa 1550 B.C. toward sunrise on sum-
mer solstice day in those times (Fig. 3).

One of the shortest yet most fierce and ferocious recent
wars in the Middle East was the Six Day War of 1967, when
the hemmed-in and besieged Israeli army defeated the armies
of Egypt, Jordan, and Syria and captured the Sinai peninsula,
the West Bank of the Jordan River, and the Golan Heights.

Star Stones

• ."•*'■<, "•*•** T All

• " ■# "/;• * . ■Ml

Figure 2

In the years that followed Israeli archaeologists conducted
extensive archaeological surveys and excavations in all those
areas, bringing to light settlements from early Neolithic times
through biblical times to Greek, Roman, and Byzantine per-
iods. Yet nowhere was the surprise greater than on the
sparsely inhabited and mostly empty plateau called the Golan
Heights. Not only was it discovered that it had been an ac-
tively inhabited and cultivated area in the earliest times of
human habitation; not only were remains of settlements
found from the several millennia preceding die Common Era.

Virtually in the middle of nowhere, on a windswept plain
(that had been used by the Israeli army for artillery practice),
piles of stones arranged in circles turned out — when viewed
from me air — to be a Near Eastern "Stonehenge" (Fig. 4).

The unique structure consists of several concentric stone
circles, three of them fully circular and two forming only

THE COSMIC CODE

Figure 3

semicircles or "horseshoes." The outer circle is almost a
third of a mile in circumference, and the other circles get
smaller as they get nearer the structure's center. The walls
of the three main stone circles rise to eight feet or more, and
their width exceeds ten feet. They are constructed of field
stones, ranging in size from small to megalithic ones that
weigh five tons and even more. In several places the circular
concentric walls are connected to each other by radial walls,
narrower than but about the same height as the circular walls.
In the precise center of the complex structure there rises a
huge yet well-defined pile of stones, measuring some sixty-
five feet across.

Apart from its unique shape, this is by far one of the
largest single stone structures in western Asia, so large in

Star Stones

Figure 4

fact that it can be seen from space by Earth-orbiting
spacecraft.

Engineers who have studied the site estimated that, even
in its present condition, it contains more man 125,000 cubic
feet of stones weighing an aggregate of close to 45,000 tons.
They estimated that it would have taken one hundred work-
men at least six years to create this monument — collect the
basalt stones, transport them to the site, place them according
to a preconceived architectural plan, and raise the walls (un-
doubtedly taller than the now-visible remains) to form the
cohesive complex structure.

All of which raises the questions, by whom was this struc-
ture built, when, and for what?

THE COSMIC CODE

Figure 5

The easiest question to answer is the last one, for the struc-
ture itself seems to indicate its purpose — at least its original
purpose. The outermost circle clearly showed that it con-
tained two breaks or openings, one located in the northeast
and the other in the southeast — locations that indicate an
orientation toward the summer and winter solstices.

Working to clear away fallen rocks and ascertain the orig-
inal layout, Israeli archaeologists exposed in the northeastern
opening a massive square structure with two extended
'"wings" that protected and hid narrower breaks in the two
next concentric walls behind it (Fig. 5); the building thus
served as a monumental gate providing (and guarding) an
entrance into the heart of the stone complex. It was in the
walls of this entryway that the largest basalt boulders, weigh-
ing as much as five and a half tons each, were found. The
southeastern break in the outer ring also provided access to
the inner parts of the structure, but there the entranceway did
not possess the monumental building; but piles of fallen
stones starting in this entranceway and leading outward from
it suggest the outlines of a stone-flanked avenue extending
in the southeastern direction — an avenue that might have
outlined an astronomical line of sight.

These indications that the place was indeed, as Stonehenge
in Britain, built to serve as an astronomical observatory (and
primarily to determine the solstices) is reinforced by the ex-
istence of such observatories elsewhere — structures that are

Star Stones

Figures 6a and 6b

even more similar to the one on the Golan, for they feature
not only the concentric circles, but also the radial walls con-
necting the circles. What is amazing is that those similar
structures are at ancient sites all the way on the other side
of the world, in the Americas.

One is the Mayan site Chichen Itza in the Yucatan peninsula
of Mexico (Fig. 6a), nicknamed the Caracol ("Snail") on

8 THE COSMIC CODE

account of the winding stairs inside the observatory's tower.
Another is the circular observatory atop the promontory of
Sacsahuaman in Peru (Fig. 6b) that overlooks the Inca capital
Cuzco; there, as at Chichen Itza, there was probably a lookout
tower; its foundations reveal the layout and astronomical
alignments of the structure and clearly show the concentric
circles and connecting radials.

Such similarities were reason enough for the Israeli sci-
entists to call in Dr. Anthony Aveni of the USA, an inter-
nationally acclaimed authority on ancient astronomies,
especially those of the pre-Columbian civilizations of the
Americas. His task was not only to confirm the astronomical
orientations underlying the design of the Golan site, but also
to help determine its age — and thus, in addition to the For
What question, also answer the question When.

That the orientation of a structure — if aligned to the sol-
stices — can reveal the time of its construction, has been an
accepted tool in archaeoastronomy since the publication of
The Dawn of Astronomy by Sir Norman Lockyer in 1894.
The apparent movement of the Sun from north to south and
back as the seasons come and wane is caused by the fact
that the Earth's axis (around which the Earth rotates to create
the day/night cycle) is inclined to the plane ("ecliptic") in
which the Earth orbits the Sun. In this celestial dance —
though it is the Earth that moves and not the Sun — it appears
to observers on Earth that the Sun, moving back and forth,
reaches some distant point, hesitates, stops, and then as if it
changed its mind, starts back; crosses the equator, goes all
the way to the other extreme, hesitates, and stops there, and
goes back. The two crossings a year over the equator (in
March and September) are called equinoxes; the two stops,
one in the north in June and one in the south in December,
are called solstices ("Sun Standstills") — the summer and
winter solstices for observers in the Earth's northern hemi-
sphere, as people at Stonehenge and on the Golan had been.

Studying ancient temples, Lockyer divided them into two
classes. Some, as the Temple of Solomon in Jerusalem and
the temple to Zeus at a place called Baalbek in Lebanon,

Star Stones 9

were built along an east-west axis that oriented them to
sunrise on the days of the equinoxes. Others, as phar-
aonic temples in Egypt, were aligned on an axis inclined
southwest-northeast, which meant that they were oriented to
the solstices. He was surprised, however, to discover that
while in the former the orientation never changed (so he called
them Eternal Temples), the latter — such as the great Egyptian
temples in Karnak — showed that as successive Pharaohs
needed to see the rays of the Sun strike the holy of holies on
the day of me solstice, they kept changing the direction of the
avenues and corridors toward a slightly different point in the
skies. Such realignments were also made at Stonehenge.

What had caused those directional changes? Lockyer's an-
swer was: changes in the Earth's inclination, resulting from
its wobble.

Nowadays the inclination of the Earth's axis ("obliquity")
to its orbital path ("ecliptic") is 23.5 degrees, and it is this
inclination that determines how far northward or southward
the Sun would appear to move seasonally. If this angle of
inclination were to remain unchanged forever, the solstice
points would also remain the same. But astronomers have
concluded that the Earth's tilt (caused by its wobble) changes
over the centuries and millennia, rising and falling over and
over again.

Right now, as in the preceding several millennia, the tilt
has been in a narrowing phase. It was over 24 degrees circa
4000 B.C., declined to 23.8 degrees circa 1000 B.C., and con-
tinued to fall to its present smidgen under 23.5 degrees. The
great innovation of Sir Norman Lockyer was to apply this
change in Earth's obliquity to the ancient temples and estab-
lish the dates of construction of the various phases of the
Great Temple in Karnak (Fig. 7) as well as for the phases of
Stonehenge (as indicated by changes in the location of the
Heel Stone, Fig. 3).

The same principles have since been used to determine the
age of astronomically oriented structures in South America
earlier this century, by Arthur Posnansky in respect to the
ruins of Tiwanaku on the shores of Lake Titicaca, and by

10

THE COSMIC CODE

CO

Figure 7

Rolf Muller for the semicircular Torreon in Machu Picchu
and the famed Temple of the Sun in Cuzco. Their meticulous
researches showed that in order to determine exactly the an-
gle of the Earth's tilt — which indicates, when elevation and
geographic position are taken into account, the structure's
age — it is essential to determine precisely where north is. It
is thus undoubtedly significant that in the case of the Golan
site, the researchers there found that the dominant and on
clear days visible peak of Mount Hermon lies precisely
north of the structure's center. Dr. Aveni and his Israeli col-
leagues, Yonathan Mizrachi and Mattanyah Zohar, were
thus able to determine that the site was so oriented as to en-
able an observer standing in its center and following a

Star Stones 1 1

sight line through the center of the northeastern gateway, to
see the Sun rise there on solstice day on a June dawn at
about 3000 B.C.!

By 2000 B.C., the scientists concluded, the Sun would have
appeared to a similar observer noticeably off-center, but
probably still within the gateway. Five hundred years later,
the structure had lost its value as a precise astronomical ob-
servatory. It was, then, sometime between 1500 and 1200
B.C. — as confirmed by carbon dating of small artifacts
recovered there — that the central stone heap was enlarged to
form a cairn — a stone mound under which a cavity has been
dug out, probably to serve as a burial chamber.

Uncannily, these phased dates are virtually identical to the
dates assigned to the three phases of Stonehenge.

Because it was protected by the mound of stones above it,
the cavity under the cairn — the presumed burial chamber — re-
mained the most intact part of the ancient site. It was located
with the aid of sophisticated seismic instruments and ground-
penetrating radar. Once a large cavity had been indicated, the
excavators (led by Dr. Yonathan Mizrachi) dug a trench that
led them into a circular chamber of over six feet in diameter
and about five feet high. It led to a larger chamber, oval in
shape, about eleven feet long and about four feet wide. The
latter's walls were constructed of six courses of basalt stones
rising in a corbelled fashion (i.e. slanting inward as the walls
rose); the chamber's ceiling was made of two massive basalt
slabs, each weighing some five tons.

There was no coffin and no body, nor any other human or
animal remains in either the chamber or antechamber. But
the archaeologists did find, as a result of meticulous sifting
of the soil, a few gold earrings, several beads made of car-
nelian semiprecious stone, flint blades, bronze arrowheads,
and ceramic shards. They therefore concluded that indeed it
was a burial chamber, but one that had been looted, probably
in antiquity. The fact that some of the stones used to pave
the chamber's floor were pried out reinforced the conclusion
that the place had been broken into by grave robbers.

12 THE COSMIC CODE

The finds have been dated to the period known as Late
Bronze Age, which extended from about 1500 to 1200 B.C.
That was the time frame of the Exodus of the Children of
Israel from Egypt under the leadership of Moses, and the
conquest of the Promised Land under the leadership of
Joshua. Of the twelve tribes, the tribes of Reuben and Gad
and half the tribe of Manasseh were allotted parts of Trans-
jordan, from the River Anion in the south to the foothills of
Mount Hermon in the north. Those domains included the
mountain range of Gilad east of the Jordan River and the
plateau that is now the Golan. It was therefore perhaps un-
avoidable that Israeli researchers turned to the Bible for an
answer to the question: Who?

According to the books of Numbers and Joshua, the north-
ern part of the Gilead mountains was ruled by a king called
Og from his capital of Bashan. The capture of Og's domain
is described in Deuteronomy (chapter 3). "Og and all his
men took the field against the Children of Israel," the nar-
rative states. Winning the battle, the Israelites captured sixty
towns that were "fortified with high walls and gates and
barriers, apart from a great number of unwalled towns." The
construction of high stone walls and gates — features of the
enigmatic Golan site — was thus within the capabilities of
the kingdoms in the time of King Og.

Og, according to the Bible, was a big and stout man: "His
iron bedstead is nine cubits long and four cubits wide"
(equivalent to over thirteen feet and six feet, respectively).
This giant size, the Bible hints, was due to his being a de-
scendant of the Repha'im, a giantlike race of demigods who
had once dwelt in that land. (Other giantlike descendants of
the Repha'im, including Goliath, are mentioned in the Bible
as siding with the Philistines at the time of David). Combin-
ing the references to the Repha'im with the biblical account
of the circular stone structure erected by Joshua after the
crossing of the Jordan River, and the naming of the place
Gilgal — "The Circular Stone Heap" — some in Israel have
nicknamed the Golan site Gilgal Repha'im — "The Circular
Stone Heap of the Repha'im."

Star Stones 13

While the biblical verses alone do not support such a nam-
ing, nor do they really link King Og to the burial chambers,
the biblical assertions that the area had once been the domain
of the Repha'im and that Og was descended of them are quite
intriguing, because we find the Repha'im and their offspring
mentioned in Canaanite myths and epic tales. The texts,
which clearly place the divine and semidivine actions and
events in the area we are dealing with here, were written on
clay tablets discovered in the 1930s at a coastal site in northern
Syria whose ancient name was Ugarit. The texts describe a
group of deities whose father was El ("God, the Lofty One")
and whose affairs centered on El's son Ba'al (' 'the Lord") and
his sister Anat ("She who answers"). The focus of Ba'al's at-
tention was the mountainous stronghold and sacred place Za-
phon (meaning both "the northern place" and "the place of
secrets") and the arena of Ba'al and his sister was what now-
adays is northern Israel and the Golan. Roaming the area's
skies with them was their sister Shepesh (the name's uncertain
meaning suggests an association with the Sun); and of her the
texts clearly state that "she governs the Repha'im, the divine
ones" and rules over demigods and mortals.

Several of the discovered texts deal with such involvement
on the part of the trio. One. titled by scholars The Tale of
Aqhat, pertains to Danel ("Whom God Judges," Daniel in
Hebrew), who — although a Rapha-Man (i.e. descended of
the Repha'im) — could not have a son. Growing old and de-
spondent about not having a male heir, Danel appeals to
Ba'al and Anat, who in turn intercede with El. Granting the
Rapha-Man's wish, El instills in him a "quickening life-
breath" and enables him to mate with his wife and have a
son whom me gods name Aqhat.

Another tale, The Legend of King Keret (Keret. "The Cap-
ital, the Metropolis," is used as the name of both the city
and its king), concerns the claim to immortality by Keret
because of his divine descent. Instead, he falls ill; and his
sons wonder aloud: "How could an offspring of El, the Mer-
ciful One, die? Shall a divine one die?" Foreseeing the seem-
ingly incredible death of a demigod, the sons envision not

14 THE COSMIC CODE

only the Peak of Zaphon. but also the Circuit of Broad Span
lamenting for Keret:

For thee, father,

shall weep Zaphon, the Mount of Ba'al.

The sacred circuit, the mighty circuit,

the circuit of broad span,

[for thee] shall lament.

There is here, then, a reference to two highly venerated
places that shall mourn the death of the demigod: Mount
Zaphon. the Mount of Ba'al — and a renowned sacred cir-
cular structure — "the sacred circuit, the mighty circuit, the
circuit of broad span." If Mount Zaphon. the "Mount of the
North," was Mount Hermon, which lies precisely north of
the Golan site, was then the Sacred Circuit the enigmatic
Golan site?

Granting appeals for mercy, El at the last moment sent the
goddess Shataqat, "a female who removes the illness." to
save Keret. "She flies over a hundred towns, she flies over
a multitude of villages" on her rescue mission; arriving at
Keret's home in the nick of time, she manages to revive him.

But being only a demigod, Keret in the end did die. Was he
then the one buried in the tomb within "the sacred circuit, the
mighty circuit, the circuit of broad span"? Though the Ca-
naanite texts give no chronological hint, it is evident that they
relate events from the Bronze Age — a time frame that could
well fit the date of the artifacts discovered in the Golan site's
tomb.

Whether or not any of those legendary rulers ended up be-
ing buried at the Golan site, we may never know for sure; es-
pecially since the archaeologists studying the site raised the
possibility of intrusive burials — namely, the entombment of a
later-deceased in a burial place from earlier times, involving
as often as not the removal of the earlier remains. They are,
however, certain (based on structural features and various dat-
ing techniques) that the construction of the "henge" — con-
centric walls of what we might dub Star Stones because of the

Star Stones 15

astronomical function — preceded, by 1,000 to 1,500 years, the
addition of the cairn and its burial chambers.

As at Stonehenge and other megalithic sites, so too re-
garding the Golan site, the enigma of who built them is only
intensified by establishing their age and determining that an
advanced knowledge of astronomy underlay their orienta-
tions. Unless they were indeed the divine beings themselves,
who was there capable of the feat — circa 3000 B.C. in the
case of the Golan site?

In 3000 B.C. there was in western Asia only one civiliza-
tion high enough, sophisticated enough, and with an extraor-
dinary astronomical knowledge, capable of planning,
orienting astronomically, and carrying out the kind of major
structures here considered: the Sumerian civilization. It blos-
somed out in what is nowadays southern Iraq, "suddenly,
unexpectedly, out of nowhere" in the words of all scholars.
And within a few centuries — an instant as human evolution
goes — accounted for virtually all the firsts of what we deem
essential to a high civilization, from the wheel to the kiln
and bricks and high-rise buildings, writing and poetry and
music, codes of law and courts, judges and contracts, temples
and priests, kings and administrators, schools and teachers,
doctors and nurses; and amazing knowledge of mathematics,
exact sciences, and astronomy. Their calendar, still in use as
the Jewish calendar, was inaugurated in a city called Nippur
in 3760 B.C. — embracing all the sophisticated knowledge re-
quired for the structures we are discussing.

It was a civilization mat preceded mat of Egypt by some
eight hundred years and by a thousand years that of the Indus
Valley. The Babylonians, Assyrians, Hittites, Elamites, Ca-
naanites, and Phoenicians followed later, some much later.
They all bore the imprint and borrowed the underlying firsts
of the Sumerians; so did the civilizations mat in time rose in
Greece and the Mediterranean islands.

Did the Sumerians venture as far as me Golan Heights?
Undoubtedly, for their kings and their merchants went west-
ward toward the Mediterranean Sea (which they called the

16 THE COSMIC CODE

Upper Sea), and sailed the waters of the Lower Sea (the
Persian Gulf) to other distant lands. When Ur was their cap-
ital, its merchants were familiar in all parts of the ancient
Near East. And one of Sumer's most famed kings, Gilga-
mesh — a famed king of Uruk (the biblical Erech) — in all
probability passed through the site. The time was circa 2900
B.C., soon after the Golan site was first constructed.

The father of Gilgamesh was the city's High Priest; his
mother was the goddess Ninsun. Aiming to be a mighty king
and aggrandize his city, Gilgamesh started his reign by chal-
lenging the authority of the then-principal city of Sumer, Kish.
A clay tablet describing the episode names the king of Kish
Agga, and twice describes him as being "stout." Kish was
then the capital of a wide domain that might have extended be-
yond the Euphrates River; and one must wonder whether the
stout king Agga might have been a forerunner of the giantlike
Og of biblical fame: for the naming of kings after earlier pred-
ecessors was a common Near Eastern practice.

Proud, ambitious, and swashbuckling in his youth, Gil-
gamesh took hard his creeping aging. To sustain his prowess
he took to dropping in on newlyweds in his city, claiming
the royal right to be the first to have sex with the bride. When
the townspeople could not stand it anymore, they appealed
to the gods for help; and the gods responded by creating a
double for Gilgamesh. who stopped the king's shenanigans.
Subdued. Gilgamesh grew gloomy and reflective. He wit-
nessed people his age or even younger dying; and then it
occurred to him that there is another way: he was. after all,
partly divine — not just a demigod, but two-thirds divine, for
it was not his father but his mother who was a goddess !

Should he. Gilgamesh, then die as a mortal, or be entitled
to the everlasting life of the gods? He presented his case to
his mother. Yes, she told him, you are right. But in order to
attain the divine life span, you must ascend the heavens and
reach the gods' abode. And the places from which such as-
cents are possible, she told him, are under the command of
his godfather Utu (later known as Shamash).

Utu/Shamash tried to dissuade Gilgamesh: "Who, Gilga-

Star Stones 17

mesh, can scale heaven? Only the gods live forever under
the Sun. As for Mankind, numbered are their days." Go, be
with your family and your townsfolk, enjoy the rest of your
days, the god said to him.

The story of Gilgamesh and his quest for immortality is
told in the Epic of Gilgamesh, a long text written on clay
tablets and discovered by archaeologists in both the original
Sumerian and various ancient translations. As the tale un-
folds, we read that Gilgamesh was not dissuaded, and an
object that fell from the skies was deemed by him a sign
from heaven that he should not give up. Agreeing to help,
Ninsun revealed to him that there is a place in the Cedar
Mountains — the Landing Place — from which Gilgamesh
could ascend to the divine abode. It would be a journey
fraught with dangers, she warned Gilgamesh. But what is the
alternative? he asked her. If I fail in my quest, he said, at
least future generations will know that 1 tried.

Giving her blessing to the journey, Ninsun insisted that
the artificial man, Enkidu, go in front of Gilgamesh and pro-
tect him along the way. The choice was opportune, for the
area of their destination was the very area from which Enkidu
had come, the hills where he had roamed with the wild
beasts. He explained to Gilgamesh how dangerous the un-
dertaking would be; but Gilgamesh insisted on going.

In order to reach the Cedar Mountains in what is now
Lebanon from Sumer (which was in what is now southern
Iraq). Gilgamesh had to cross the plateau that we now call
the Golan. And indeed we find it stated, in the preamble to
the epic in which the king's adventures and achievements are
enumerated, that it was "he who opened the mountain
passes." It was a first that merited recalling, for there are no
mountains in the land called Sumer.

On their way Gilgamesh stopped several times to seek
divine oracles from the Sun God. When they reached the hill
land and the woodlands (the likes of which there were none
in Sumer), Gilgamesh had a series of omen-dreams. At a
crucial stop, from where they could already see the Cedar
Mountains, Gilgamesh sought to induce a dream-omen by

18 THE COSMIC CODE

Figure 8

sitting within a circle that was formed for him by Enkidu.
Was it Enkidu, possessing superhuman strength, who ar-
ranged the field stones for Gilgamesh to form Star Stones?

We can only guess. But physical evidence attesting to the
familiarity of those who had lived on the Golan Heights for
generations with Gilgamesh and his tale has recently been
found on the Heights.

One of the most recounted episodes in the king's adventures
has been the incident in which he encountered two ferocious
lions, fought them off, and killed mem with his bare hands.
The heroic deed was a favorite subject of Near Eastern artists
in antiquity. Yet it was a totally unexpected discovery to find,
at a site near the concentric circles, a stone slab with such a de-
piction (Fig. 8)! (The artifact is on exhibit at the new and
most-interesting Golan Archaeological Museum in Qatzrin).

While the textual references and the depiction on the stone
slab do not constitute conclusive evidence that Gilgamesh
reached the site on his journey to the Cedar Mountains of
Lebanon, there is one more intriguing clue to be considered.
After the site was identified from the air. the Israeli archae-
ologists discovered that it was marked on (captured) Syrian
army maps by the name Rugum el-Hiri — a most puzzling
name, for it meant in Arabic "Stone heap of the bobcat."

The explanation for the puzzling name, we suggest, may
well lie in the Epic of Gilgamesh, reflecting a memory of the
King Who Fought the Lions.

And, as we shall see, that is just the beginning of intricate
and interwound associations.

FATE HAS TWELVE STATIONS

Scholars have long recognized that in the lore of diverse
nations the same theme, the same basic tale, appears and
reappears though under different guises, names, and locali-
ties. It is thus perhaps no wonder that the carved basalt stone
on which Gilgamesh is depicted fighting with the lions was
discovered near a village bearing the name Ein Samsum —
"Samson"s Spring." For, it will be recalled, Samson also
fought and killed a lion with his bare hands. That was some
two thousand years after Gilgamesh, and certainly not on the
Golan Heights. Is the village's name, then, just a coinci-
dence, or the lingering memory of a visitor called Gilgamesh
becoming Samson?

Of greater significance is the association with King Keret.
Though the venue of the Canaanite tale is not stated, it is
presumed by many (e.g. Cyrus H. Gordon, Notes on the Leg-
end of Keret) that the combined name for the king and his
capital in fact identified the island of Crete. There, according
to Cretan and Greek legends, civilization began when the god
Zeus saw Europa, the beautiful daughter of a king of Phoe-
nicia (present-day Lebanon) and. taking the form of a bull,
abducted her and swam with her on his back across the Med-
iterranean Sea to the island of Crete. There he had three sons
by her, among them Minos, who in time became the one
with whom the beginning of Cretan civilization is associated.

Thwarted in his aspirations to the throne. Minos appealed
to Poseidon, god of the seas, to bestow upon him a sign of
divine favor. In response, Poseidon made a Divine Bull, pure
white, appear from the sea. Minos vowed to offer the beau-

19

20

THE COSMIC CODE

■4 \-

Figure 9

tiful bull as a sacrifice to the god, but was so enthralled by
it that instead he kept it to himself. In punishment, the god
made the king's wife fall in love and mate with the bull; the
offspring was the legendary Minotaur, a half-man, half-bull
creature. Minos then commissioned the divine craftsman
Daedalus to build in the Cretan capital Knossos an under-
ground maze from which the bull-man would be unable to
escape. The maze was called the Labyrinth.

A huge stone sculpture of a bull's horns does greet the
visitor to the excavated remains of Knossos, but not the re-
mains of the Labyrinth. Yet its memory and its circular
shape, as a maze of concentric circular walls with passages
blocked by radials (as in this suggested layout. Fig. 9) have
not been forgotten.

It certainly resembles the layout of the Golan site; and it
calls for going back to the Epic of Gilgamesh for the heroes'
encounter with the Bull of Heaven.

As the epic tells it, during the final night before attempting
to enter me Cedar Forest. Gilgamesh envisioned a rocketship
thunderously rising, in a fiery ascent, from the Landing
Place. The next morning they found the hidden entry way into

Fate Has Twelve Stations

21

Figure 10

the forbidden enclosure; but no sooner did they start on their
way in than a robotic guardian blocked their way. It was
"mighty, its teeth as the teeth of a dragon, its face of a
ferocious lion, its advance like the onrushing headwaters."
A "radiating beam" emanated from its forehead, "devouring
trees and bushes"; "from its killing force, none could es-
cape."

Seeing the predicament of Gilgamesh and Enkidu, Utu/
Shamash "down from the skies spoke to the heroes." He
advised them not to run, but instead to draw near the monster
as soon as the god would blow a swirling wind whose dust
would blind the guardian. As soon as that happened. Enkidu
struck and killed it. Ancient artists depicted on cylinder seals
(Fig. 10) Gilgamesh, Enkidu, and Utu/Shamash together with
the menacing robot; its depiction brings to mind the biblical
description of the "angels with the whirling sword" that God
placed at the entrance to the Garden of Eden to make sure
that the expelled Adam and Eve would not reenter it.

The fight was also watched by Inanna (later known as
Ishtar), the twin sister of Utu/Shamash. She had quite a rec-
ord of enticing human males to spend a night with her — a
night which they rarely survived. Captivated by the beauty
of Gilgamesh as he bathed naked in a nearby river or wa-
terfall, she invited him: "Come, Gilgamesh, be my lover!"
But knowing the record, he turned her down.

Enraged by this insulting refusal, Ishtar summoned the

22 THE COSMIC CODE

Bull of Heaven to smite Gilgamesh. Running for their lives,
the duo rushed back to Uruk; but the Bull of Heaven caught
up with them on the banks of the Euphrates River. At the
moment of mortal danger it was again Enkidu who managed
to strike and kill the Bull of Heaven.

Inanna/lshtar, enraged, "sent up a wail to Heaven," de-
manding mat the two comrades be put to death. Though tem-
porarily spared, Enkidu died first; then so did Gilgamesh
(after a second journey that took him to a spaceport in the
Sinai peninsula).

What was the Bull of Heaven — GUD.ANNA in Sume-
rian? Many students of the Epic, such as Giorgio de Santil-
lana and Hertha von Dechend in Hamlet's Mill, have come
to the conclusion mat the Epic's events, taking place on
Earth, are but a mirror image of events taking place in
Heaven. Utu/Shamash is the Sun, Inanna/lshtar is what she
was later called in Greek and Roman times — Venus. The
menacing guardian of the Cedar Mountains with me face of
a lion is the constellation of Leo (the Lion), and the Bull of
Heaven the celestial group of stars that has been called —
since Sumerian times! — the constellation of the Bull (Tau-
rus).

There are, indeed, Mesopotamian depictions with the Lion/
Bull theme (Fig. 11a and lib); and as was first remarked
upon by Willy Hartner (The Earliest History of the Constel-
lations in the Near East), in the fourth millennium B.C. the
Sumerians would have observed the two constellations in key
zodiacal positions: the constellation of the Bull (Taurus) as
the constellation of the spring equinox and the constellation
of the Lion (Leo) as that of the summer solstice.

The attributing of zodiacal connotations to epic events on
Earth, as told by the Sumerians, implies mat they had such
celestial knowledge — in the fourth millennium B.C., some
three millennia before the usually presumed time of the
grouping of stars into constellations and the introduction of
the twelve zodiacal ones by the Greeks. In fact, the Greek
savants (of Asia Minor) themselves explained that the knowl-
edge came to them from the "Chaldeans" of Mesopotamia;

Fate Has Twelve Stations

23

Figures 11a and lib

and, as Sumerian astronomical texts and pictorial depictions
attest, the credit should go to them. Their names and symbols
for the zodiacal constellations remained unchanged to our
time.

The Sumerian zodiacal lists began with Taurus, which was
indeed the constellation from which the Sun was observed
rising at dawn on the day of the spring equinox in the fourth
millennium B.C. It was called in Sumerian GUD.ANNA
("Bull of Heaven" or "Heavenly Bull") — the very same
term used in the Epic of Gilgamesh for the divine creature
that Inanna/Ishtar had summoned from the heavens and that
the two comrades slew.

Did the slaying represent or symbolize an actual celestial
event, circa 2900 B.C.? While the possibility cannot be ruled
out, the historical record indicates that major events and
changes did occur on Earth at that time; and the "slaying"
of the Bull of Heaven represented an omen, a heavenly
omen, predicting or even triggering events on Earth.

For the better part of the fourth millennium B.C. the Su-
merian civilization was not only the greatest on Earth, but
also the only one. But circa 3100 B.C. the Civilization of the
Nile (Egypt and Nubia) joined the one on the Euphrates-

24 THE COSMIC CODE

Figure 12

Tigris Rivers. Did this split-up on Earth — alluded to by the
biblical tale of the Tower of Babel and the end of the era
when Mankind spoke one tongue — find expression in the de-
scription (in the Gilgamesh epic) of the coup de grace dealt
the Bull of Heaven by the tearing off of its foreleg by Enk-
idu? Egyptian celestial-zodiacal depictions indeed associated
the beginning of their civilization with the cutting off of the
forepart of the constellation of the Bull (Fig. 12).

As we have detailed in The Wars of Gods and Men, In-
anna/Ishtar had expected at that time to become mistress of
the new civilization, but it was — literally and symbolically —
torn away from her. She was partly appeased when a third
civilization, that of the Indus Valley, was put under her aegis,
circa 2900 B.C.

As significant as celestial omens had been for the gods,
they were even more consequential to mortals on Earth; wit-
ness the fate that befell the two comrades. Enkidu, an arti-
ficially created being, thed as a mortal. And Gilgamesh,
two-thirds divine, could not escape mortality. Though he
went on a second journey, enduring hardships and dangers,
and though he did find the Plant of Everlasting Youth, he
returned to Uruk empty-handed. According to the Sumerian
King List, "the divine Gilgamesh. whose father was a hu-
man, the High Priest of the temple precinct, ruled 126 years;
Urlugal, son of Gilgamesh, ruled after him."

We can almost hear the son of Gilgamesh crying out, as

Fate Has Twelve Stations 25

did the sons of King Keret: "How could an offspring of El,
The Merciful One, die? Shall a divine one die?" But Gil-
gamesh, though more than a demigod, tangled with his Fate.
His was the Age of the Bull, and he slew it; and his Fate, a
Fate made in Heaven, changed from a chance for immortality
to that of a mortal's death.

A thousand years after the probable stay of Gilgamesh at
me Golan site, it was visited by another ancient VIP who
also saw Fate written in the zodiacal constellations. He was
Jacob, the grandson of Abraham; and the time, by our cal-
culations, was about 1900 B.C.

A question that is often ignored regarding the megalithic
structures around the globe is, Why have they been con-
structed where they are? The location obviously had to do
with their particular purpose. The great pyramids of Giza, we
have suggested in our writings, served as anchors for a Land-
ing Corridor leading to a spaceport in the Sinai peninsula,
and were emplaced precisely because of that link on the thir-
tieth parallel north. Stonehenge, it was suggested by leading
astronomers, was erected where it is because it is precisely
there that its astronomical functions could combine both solar
and lunar observations. Until more might come to light con-
cerning the Golan Circles, the most likely reason for its being
where it is was that it lay astride one of the few linkways
that connected two major international routes (in antiquity
and still now): the King's Highway, which ran along the hills
east of the Jordan River, and the Way of the Sea, which ran
on the west along the coast of the Mediterranean Sea (Map).
The two routes connected Mesopotamia and Egypt, Asia and
Africa — be it for peaceful trade or military invasions. The
links between the two routes were dictated by geography and
topography. At the Golan site, the crossing could be made
on either side of the Sea of Galilee (Lake Kinnereth); the
preferred one — then and now — is the one on me north,
where the bridge has retained its ancient name: The Bridge
of the Daughters of Jacob.

26

THE COSMIC CODE

The Golan site was thus located where travelers from dif-
ferent nations and diverse homelands could stop and scan the
heavens for omens, to seek out clues regarding their Fates,
perhaps to mingle at a neutral site because it was sacred, and
there negotiate issues of war or peace.

Based on biblical and Mesopotamian data, we believe
that this was what Jacob had used the site for.

Fate Has Twelve Stations 27

The story began two centuries earlier, in Sumer; and it
began not with Jacob's grandfather Abraham but with Ja-
cob's great-grandfather, Terah. His name suggests that he
was an oracle priest (Tirhu); the family's care to be known
as Ibri (Hebrew) people suggests to us that they considered
themselves to be Nippurians — people from the city Nippur
that in Sumerian was rendered NI.IBRU — "The Beautiful/
Pleasant Abode of Crossing." The religious and scientific
center of Sumer, Nippur was the site of the DUR.AN.KI, the
"Bond Heaven-Earth," located in the city's sacred precinct.
It was the focal point for the preservation, study, and inter-
pretation of accumulated astronomical, calendrical, and ce-
lestial knowledge; and Abraham's father, Terah, was one of
its priests.

Circa 2100 B.C. Terah was transferred to Ur. The time was
a period known to Sumerologists as Ur III, for it was then
that Ur, for the third time, became the capital not only of
Sumer, and not only of an enlarged political entity called
Sumer and Akkad, but also of a virtual empire that flourished
and was held together not by force of arms but by a superior
culture, a unified pantheon (what is known as Religion), a
capable administration, and — not least of all — a thriving
trade. Ur was also the cult-center of the Moon god Nannar
(later known by the Semitic people as Sin). Rapidly devel-
oping events in Sumer and beyond triggered first the transfer
of Terah to Ur and then to a distant city called Harran. Sit-
uated on the Upper Euphrates and its tributaries, the city
served as a major crossroads and trading post (which its
name, meaning the Caravanry, indicated). Founded by Su-
merian merchants, Harran also boasted a large temple to the
Moon god, so much so that the city was looked upon as an
"Ur away from Ur."

On these transfers Terah took with him his family. The
move to Harran included Abram (as he was then called),
Terah's firstborn; a son called Nahor; the two sons' wives,
Sarai (later renamed Sarah) and Milcah; and Terah's grand-
son Lot, me son of Abram's brother Haran who had died in
Ur. They dwelt there, in Harran, "many years" according to

28 THE COSMIC CODE

the Bible, and it was there that Terah died when he was 205
years old.

It was after that that God said unto Abram: "Get thee out
of thy country, and out of thy birthplace, and from thy fa-
ther's dwelling place, unto the land that I will show thee...
There I will make thee unto a great nation, and I will bless
thee and make great thy name." And Abram took Sarai his
wife and Lot his nephew and all the people in their household
and all of their belongings, and went to the Land of Canaan;
"and Abram was seventy-five years old when he departed
from Harran." His brother Nahor stayed behind, with his
family, in Harran.

Acting on divine instructions, Abram moved quickly in
Canaan to establish a base in the Negev, the arid area of
Canaan bordering the Sinai peninsula. On a visit to Egypt he
was received in the Pharaoh's court; back in Canaan, he dealt
with the local rulers. He then played a role in an international
conflict, known in the Bible (Genesis 14) as the War of the
Kings. It was after that that God promised Abram that his
"seed" should inherit and rule the lands between the Brook
of Egypt and the Euphrates River. Doubting the promise,
Abram pointed out that he and his wife Sarai had no children.
So God told Abram not to worry. "Look now toward the
heavens." he told him, "and count the stars if you can...
so numerous shall be thy seed." But Sarai remained barren
even after that.

So, at her suggestion Abram slept with her handmaiden
Hagar, who did bear him a son, Ishmael. And then, mirac-
ulously — after the upheaval of Sodom and Gomorrah, when
the couple's names were changed to Abraham and Sarah —
Abraham, then aged one hundred, had a son by his wife
Sarah, aged ninety. Though not the firstborn, Sarah's son,
Isaac, was the Legitimate Heir under the Sumerian succes-
sion rules that the Patriarch followed; for he was a son of
his father's half sister: "the daughter of my father but not of
my mother," Abraham said of Sarah (Genesis 20: 12).

It was after the death of Sarah, his lifelong companion,
that Abraham, "old and advanced in years" (137 years, by

Fate Has Twelve Stations 29

our calculations) became concerned about his unmarried son
Isaac. Fearing that Isaac would end up marrying a Canaanite.
he sent the overseer of his household to Harran, to find there
a bride for Isaac from among the relatives mat had remained
there. Arriving at the dwelling village of Nahor, he met at
the watering well Rebecca, who turned out to be Nahor's
granddaughter and ended up going to Canaan to become
Isaac's wife.

Twenty years after they got married Rebecca gave birth to
twins, Esau and Jacob. Esau was first to get married, taking
two wives right off, both of them Hittite lasses; "they were
a source of grief to Isaac and Rebecca." The troubles are
not detailed in the Bible, but the situation between mother
and daughters-in-law was so bad that Rebecca told Isaac: "1
am disgusted with life on account of the Hittite women;
should Jacob too marry such a Hittite woman, of the local
females, what good would life be to me?" So Isaac called
Jacob and instructed him to go to Harran, to his mother's
family, to find there a bride. Heeding his father's words,
"Jacob left Beersheba and set out for Harran."

Of Jacob's journey from the south of Canaan to distant
Harran, the Bible reports only one episode — though a very
significant one. It was the nighttime vision by Jacob, "as he
came upon a certain place," of a stairway to heaven on
which Angels of the Lord were ascending and descending.
Awakened, Jacob realized that he had come upon "a place
of the Elohim and a gateway to heaven." He marked the
place by setting up there a commemorative stone, and named
the site Beth-El — "The House of El," the Lord. And then,
by a route that is not stated, he continued to Harran.

On the city's outskirts he saw shepherds gathering with
their flocks at a well in the field. Addressing them, Jacob
inquired whether they knew Laban, his mother's brother. In-
deed we know him, the shepherds said, and here comes his
daughter Rachel, shepherding his flocks. Bursting into tears,
Jacob introduced himself as the son of Rebecca, her aunt.
No sooner did Laban hear the news than he, too, came run-
ning, hugging and kissing his nephew, inviting him to stay

30 THE COSMIC CODE

with him and meet his other daughter, the older Leah. Mar-
riage was clearly in the father's mind; but Jacob fell in love
with Rachel, and offered to work for Laban seven years in
lieu of a dowry. But on the night of the wedding, after the
banquet, Laban substituted Leah for Rachel in the bridal
bed...

When Jacob discovered the bride's identity in the morning,
Laban was nonplussed. Here, he said, we do not marry off
the younger daughter before her elder sister; why don't you
work for me another seven years, and then marry Rachel,
too? Still in love with Rachel, Jacob agreed. After seven
years, he married Rachel; but the wily Laban held on to the
hard worker and capable shepherd that Jacob was, and would
not let him go. To keep Jacob from leaving, he let him start
raising his own flocks: but the more Jacob succeeded, the
more were Laban's sons grumbling with envy.

And so it was, when Laban and his sons were away to
shear their flocks of sheep, that Jacob gathered his wives and
children and flocks and fled Harran. "And he crossed the
river" — the Euphrates — "and set his course toward the
mount of Gile'ad."

"On the third day it was told to Laban mat Jacob had
escaped; so he took his kinfolk with him and pursued after
Jacob; and after seven days he caught up with him at the
mount of Gilead."

Gilad — "The Everlasting Stone Heap" in Hebrew —
the site of the circular observatory in the Golan!

The encounter started with bitter exchanges and reciprocal
accusations. It ended with a peace treaty. In the manner of
boundary treaties of the time, Jacob selected a stone and
erected it to be a Witnessing Pillar, to mark the boundary be-
yond which Laban would not cross into Jacob's domains nor
would Jacob cross to Laban's domains. Such boundary stones,
called Kudurru in Akkadian because of their rounded tops,
have been discovered at various Near Eastern sites. As a rule,
they were inscribed with details of the treaty and included the
invoking of each side's gods as witnesses and guarantors. Ad-
hering to the custom, Laban called for "he God of Abraham

Fate Has Twelve Stations 31

and the gods of Nahor" to guarantee the treaty. Apprehensive,
Jacob "swore by the fear of his father Isaac." Then he added
his own touch to the occasion and the place:

And Jacob said to his sons:

Gather stones;

And they gathered stones

and arranged them in a heap...

And Jacob called the stone heap

Gated.

By a mere change of pronunciation, from Gilad to Gal-
Ed, Jacob changed the meaning of the name from its long-
standing "The Everlasting Stone Heap" to "The Stone Heap
of Witnessing."

How certain can we be that the place was that of the Golan
circles' site? Here, we believe, is the convincing final clue:
In his oath of treaty, Jacob also described the site as Ha-
Mitzpeh — the Observatory!

The Book of Jubilees, an extrabiblical book that recounted
the biblical tales from varied early sources, added a postscript
to the recorded event: "And Jacob made there a heap for a
witness, wherefore the name of the place is called The Heap
of Witness'; but before they used to call the land of Gilead
the Land of the Repha'im."

And thus we are back to the enigmatic Golan site and its
nickname Gilgal Repha'im.

The Kudurru boundary stones that have been found in the
Near East bore, as a rule, not just the terms of the agreement
and the names of the gods invoked as its guarantors, but also
the gods' celestial symbols — sometimes of the Sun and
Moon and planets, sometimes of the zodiacal constellations
(as in Fig. 13) — all twelve of them. For that, since the earliest
Sumerian times, was the count — twelve — of the zodiacal
constellations, as evidenced by their names:

32

THE COSMIC CODE

Figure 13

GUD.ANNA— Heavenly Bull (Taurus)

MASH.TAB.BA— Twins (Gemini)

DUB — Pincers, Tongs (Cancer)

UR.GULA— Lion (Leo)

AB. SIN— Whose Father Was Sin ("the Maiden" =
Virgo)

Zl.BA.AN.NA— Heavenly Fate ("the Scales" = Li-
bra)

GIR.TAB— Which Claws and Cuts (Scorpio)

PA.BIL — the Defender ("the Archer" = Sagittarius)

SUHUR.MASH— Goat-Fish (Capricorn)

GU — Lord of the Waters (Aquarius)

SIM.MAH— Fishes (Pisces)

KU.MAL— Field Dweller (the Ram = Aries)

Fate Has Twelve Stations

33

tMS

Figure 14

While not all the symbols depicting the twelve zodiacal
constellations have survived from Sumerian times, or even
Babylonian times, they have been found on Egyptian mon-
uments, in identical depictions and names (Fig. 14).

Should anyone doubt that Abraham, a son of the
astronomer-priest Terah, was aware of the twelve zodiacal
houses when God told him to observe the skies and see
therein the future? As the stars you observe in the heavens,
so shall thy offspring be, God told Abraham; and when his

34 THE COSMIC CODE

first son was born by the handmaiden Hagar, God blessed
the boy, Ishmael ("By God Heard", by this prophecy:

As for Ishmael:

Indeed I have heard him.

By this do I bless him:

I will make him fruitful

and I will multiply him exceedingly:

Of him twelve chieftains will be born,

his shall be a great nation.

Genesis 17:20

With that prophetic blessing, linked to the starry heavens
as observed by Abraham, does the Bible for the first time
record the number twelve and its significance. It then relates
(Genesis 25) that Ishmael's sons — each a chief of a tribal
state — indeed numbered twelve. Listing them by their names,
the Bible emphasizes: "Those were the sons of Ishmael ac-
cording to their courts and strongholds — twelve chieftains,
each to his own nation." Their domains encompassed Arabia
and the desertland to its north.

The next time the Bible employs the number twelve is in
listing Jacob's twelve sons at the time when he was back at
his famer's estate in Hebron. "And the number of me sons
of Jacob was twelve," the Bible states in Genesis 35, listing
them by the names that later became familiar as names of
the Twelve Tribes of Israel:

Six by Leah:

Reuben, Simeon, Levi, Judah, Issachar, Zebulun.

Two by Rachel:

Joseph, Benjamin.

Two by Bilhah, Rachel's handmaiden:

Dan, Naphtali.

And two by Zilpah, Leah's handmaiden:

Gad and Asher.

Fate Has Twelve Stations 35

There is, however, sleight of hand in this list: This was
not the original count of the twelve children who came back
with Jacob to Canaan: Benjamin, the youngest, was born by
Rachel when the family was already back in Canaan, in Beth-
lehem, where she died while giving birth. Yet the number of
Jacob's children was twelve before that: The last child born
by Leah was a daughter, Dinah. The list — perhaps by more
than a coincidence — was thus made up of eleven males and
one female, matching the list of zodiacal constellations that
is made up of one female (Virgo, the Virgin) and eleven
"male" ones.

The zodiacal implications of the twelve children of Jacob
(renamed Israel after he had wrestled with a divine being
when crossing the Jordan River) can be discerned twice in
the continuing biblical narrative. Once, when Joseph — a
master of having and solving dream-omens — boasted to his
brothers that he had dreamed that the Sun and the Moon (the
elder Jacob and Leah) and eleven Kokhavim were bowing to
him. The word is usually translated "stars," but the term
(stemming from the Akkadian) served equally to denote con-
stellations. With Joseph's, the total added up to twelve. The
implication, that his was a superior constellation, annoyed
greatly his brothers.

The next time was when Jacob, old and dying, called his
twelve sons to bless them and foretell their future. Known
as the Prophecy of Jacob, the last words of the Patriarch
begin by associating the eldest son, Reuben, with Az — the
zodiacal constellation of Aries (which, by then, was the con-
stellation of the spring equinox instead of Taurus). Simeon
and Levi were lumped together as the Twins, Gemini; be-
cause they had killed many men when they revenged the rape
of their sister, Jacob prophesied, they would be dispersed
among the other tribes and forfeit their own domains. Judah
was compared to a Lion (Leo) and foreseen as the holder of
the royal scepter — a prediction of Judea's kingship. Zebulun
was envisioned as a Dweller of the Seas (Aquarius), which
he indeed became. The predictions of the twelve tribal sons'
future continued, linked by name and symbol to the zodiacal

36 THE COSMIC CODE

constellations. Last were Rachel's sons: Joseph was depicted
as the Bowman (Sagittarius); and the last one, Benjamin —
having substituted for his sister Dinah (Virgo) — was de-
scribed as a predator that feeds off others.

The strict adherence to the number twelve, emulating the
twelve houses of the zodiac, involved another sleight of hand
that usually escapes notice. After the Exodus and the division
of the Promised Land among the Twelve Tribes, they again
included some rearrangement. Suddenly the account of the
Twelve Tribes who shared territories lists the two sons of
Joseph (who were born to him in Egypt) — Manasseh and
Ephra'im. The list, nevertheless, stayed at twelve: for, as
prophesied by Jacob, the tribes of Simeon and Levi did not
share in the territorial distributions and, as foretold, were
dispersed among the other tribes. The requirement — the
sanctity — of the Celestial Twelve was again preserved.

Archaeologists excavating the remains of Jewish syna-
gogues in the Holy Land are sometimes puzzled to find the
floors of such synagogues decorated with the zodiacal circle
of twelve constellations, depicted by their traditional symbols
(Fig. 15). They tend to view the finds as aberrations resulting
from Greek and Roman influences in the centuries before
Christianity. Such an attitude, stemming from the belief that
the practice was prohibited by the Old Testament, ignores
the historical record — the Hebrews' familiarity with the zo-
diacal constellations and their association with predictions of
the future — with Fate.

For generations and to this day, one can hear cries of
Mazal-tov! Mazal-lov! at Jewish weddings or when a boy is
circumcised. Ask anyone what it means, and the answer will
be: It means "Good Luck," let the couple or boy have good
luck with them.

Few realize, however, that though that is what is intended,
that is not what the phrase means. Mazal-tov literally means
"a good/favorable zodiacal constellation." The term comes
from the Akkadian (the first or Mother Semitic language), in
which Manzalu meant "station" — the zodiacal station in

Fate Has Twelve Stations

37

Figure 15

which the Sun was seen to "station" itself on the day of
wedding or birth.

Such an association of one's zodiacal house with one's
Fate is in vogue through horoscopic astrology, which starts
by establishing (through the date of birth) what sign one is —
a Pisces, a Cancer, or any other of the twelve zodiacal con-
stellations. Going back, we could say that according to the
Prophecy of Jacob, Judah was a Leo, Gad a Scorpio, and
Naphtali a Capricorn.

The observation of the heavens for fateful indications, a
task performed by a corps of astronomer -priests, assumed a
key role in royal decisions during Babylonian times. The fate
of the king, the fate of the land and of nations were divined
from the position of the planets in a particular zodiacal con-

38 THE COSMIC CODE

stellation. Royal decisions awaited the word of astronomer-
priests. Was the Moon, expected in Sagittarius, obscured by
clouds? Had the comet seen in Taurus moved on to another
constellation? What was the meaning for the king or the land
of the observation that, on the same evening, Jupiter rose in
Sagittarius, Mercury in Gemini, and Saturn in Scorpio? Rec-
ords literally requiring hundreds of tablets reveal that those
heavenly phenomena were interpreted to foretell invasions,
famines, floodings, civil unrest — or, on tie other hand, long
life for the king, a stable dynasty, victory in war, prosperity.
Most of the records of such observations were written down
as straight prose on clay tablets; sometimes, the astrological
almanacs, as horoscopical handbooks, were illustrated with
the symbols of the relevant zodiacal constellations. In all
instances, Fate was deemed to be indicated by the heavens.

Today's horoscopic astrology's roots go back well beyond
the Babylonians, the "Chaldeans" of Greek reports. Coupled
with the twelve-month calendar, the notion that Fate and the
Zodiac are two aspects of the same course of events un-
doubtedly began at least when the calendar began — in Nip-
pur, in 3760 B.C. (which is when the count of the Jewish
calendar began). That such an association is really that old
can be gleaned, in our opinion, from one of the Sumerian
constellation names, that of ZI.BA.AN.NA. The term, un-
derstood to mean "Heavenly Fate," literally means "Life-
Decision in the heavens" as well as "The Heavenly Scales
of Life." This was a concept that was recorded in Egypt in
the Book of the Dead; it was a belief that one's hope for an
eternal afterlife depends on the weighing of his heart on the
Day of Judgment. The scene was magnificently depicted on
the Papyrus of Ani, where the god Anubis is shown weighing
the heart in a balance and the god Thoth, the Divine Scribe,
recording the result on a pallet (Fig. 16).

An unsolved puzzle in Jewish traditions is why the biblical
Lord had chosen the seventh month, Tishrei, as the month in
which the Hebrew New Year was to begin, rather than start-
ing it in the month counted in Mesopotamia as the first
month. Nissan. If it was. as has been suggested by way of

Fate Has Twelve Stations

39

Figure 16

an explanation, a desire to enforce a clear break from the
Mesopotamian veneration of stars and planets, why still call
it the seventh month and not renumber it the first month?

It seems to us that the opposite is true, and that the answer
lies in the very name of the constellation ZI.BA.AN.NA and
its connotation of the Scales of Fate. We believe that the
crucial clue is the calendrical link with the zodiac. At the
time of the Exodus (mid-second millennium B.C.) the first
constellation, that of the spring equinox, was Aries, not Tau-
rus anymore. And starling with Aries, the constellation of the
Heavenly Scales of Life was indeed the seventh. The month
in which the Jewish New Year was to begin, the month in
which it would be decided in heaven who is to live and who
is to die, who is to be healthy or to be sick, to be richer or
poorer, happy or unhappy — was me month mat paralleled
the zodiacal month of me Celestial Scales.

And in the heavens, Fate had twelve stations.

DIVINE GENERATIONS

The twelve-part zodiac and its antiquity stir up two puzzles:
Who originated it and why was the celestial circle divided
into twelve parts?

The answers require the crossing of a threshold — to a re-
alization that underlying the seemingly astrological signifi-
cance of dividing the heavens into twelve parts is a highly
sophisticated astronomy — an astronomy, in fact, so advanced
that Man, by himself, could not have possessed it when this
division of the celestial circle began.

In its annual orbit around the Sun, the Sun appears to be
rising each month — a twelfth part of the year — in a different
station. But the one that counts most, the one mat was
deemed crucial in antiquity and which determines the tran-
sition from Age to Age (from Taurus to Aries to Pisces and
soon to Aquarius), is the one in which the Sun is seen rising
on the day of the spring equinox (Fig. 17). As it happens,
the Earth in its annual orbit around the Sun does not return
to the exact same spot. Owing to a phenomenon called Pre-
cession, mere is a slight retardation; it accumulates to one
degree every 72 years. The retardation (assuming each of the
twelve segments to be equal, 30 degrees each) thus requires
2,160 years (72 x 30) to execute a shift from sunrise on
equinox day against the starry background of one zodiacal
constellation (e.g. Taurus) to the one before it (i.e. Aries) —
while the Earth orbits the Sun in a counterclockwise direc-
tion, me retardation causes the Day of the Equinox to shift
backwards.

Now, even with me longer longevity in Sumerian/biblical

40

Divine Generations 4 1

»1« AC

/>n — £■

\X

10MQ K l* 1 ^

JOMO K

Figure 17

times (Terah 205, Abraham 175) it would have taken a life-
time to notice a retardation of one (72 years) or two (144
years) degrees — a highly unlikely achievement without the
advanced astronomical equipment mat would be needed.
So much more the ability to realize and verify a complete
Zodiacal Age shift of 2,160 years. Even the pre-Diluvial Pa-
triarchs with what scholars consider "fantastic" longevities —
969 years for the record holder Methuselah and 930 for
Adam — did not live long enough to observe a full zodiacal
period. Noah, the hero of the Deluge, lived a mere 950 years;
yet Sumerian recollections of the event named the zodiacal
constellation — Leo — in which it had happened.

This was only part of the impossible knowledge possessed
by the Sumerians. How could they have known all that they
did? They themselves provided the answer: All that we know
was taught to us by the Anunnaki — "Those Who From
Heaven to Earth Came." And they, coming from another
planet with a vast orbital period and a longevity in which

42 THE COSMIC CODE

one year encompassed 3,600 of Earthlings', had no difficulty
discerning Precession and devising the twelve-part Zodiac.

In a series of texts which formed the basis of ancient sci-
ence and religion, and which were rendered later on in other
tongues, including the biblical Hebrew, the Sumerians' tales
of the Anunnaki — of the ancient gods — have been the stuff
of which "mythology" was made. In the Western cultures
the mythology that jumps first to mind is that of the Greeks;
but it, as all the ancient mythologies and divine pantheons
of all the nations — all over the world — stemmed from the
original Sumerian beliefs and texts.

There was a time, the Sumerians told, when civilized Man
was not yet on Earth, when animals were only wild and
undomesticated and crops were not yet cultivated. At that
long-ago time there arrived on Earth a group of fifty Anun-
naki. Led by a leader whose name was E.A. (meaning
"whose home is water"), they journeyed from their home
planet NIBIRU ("planet of crossing") and, reaching Earth,
splashed down in the waters of the Persian Gulf. A text
known to scholars as the "myth" of Ea and the Earth de-
scribes how that first group waded ashore, finding themselves
in a marshland. Their first task was to drain the marshes,
clear river channels, check out food sources (found to be fish
and fowl). They then began to make bricks from the clay of
the soil and established the first-ever settlement on Earth by
extraterrestrials. They named the habitat ERIDU, which
meant "Home in the Faraway" or "Home away from
home." That name is the origin of the name "Earth" in
some of the oldest languages. The time: 445,000 years ago.

The astronauts' mission was to obtain gold by extracting
it from the waters of the gulf — gold needed for survival on
Nibiru; for there the planet was losing its atmosphere and
thus also its internal heat, slowly endangering continued life
on Nibiru. But the plan proved unworkable, and the leaders
back home decided that gold could be obtained only the hard
way — by mining it where it was in abundance, in southeast-
ern Africa.

The new plan called for a substantial increase in the num-

Divine Generations 43

ber of Anunnaki on Earth, and in rime they numbered six
hundred. There was also a need for an elaborate operation
of shipping out from Earth the refined gold and bringing in
varied supplies. For that three hundred additional Nibiruans
were employed as IGI.GI ("Those Who Observe and See"),
operating orbiting platforms and shuttlecraft. Nibiru's ruler,
AN ("The Heavenly One" — Anu in Akkadian) came to
Earth to supervise the expanded presence and operations. He
brought along with him two of his children: his son EN.LIL
("Lord of the Command"), a strict disciplinarian, to serve
as Chief of Operations; and a daughter. NIN.MAH ("Mighty
Lady"), Chief Medical Officer.

The division of duties between the pioneer Ea and the
newly arrived Enlil proved tricky, and at a certain moment
of impasse Anu was willing to stay on earth and let one of
his sons act as viceroy on Nibiru. In the end the three drew
lots. Anu returned to reign on Nibiru; Enid's lot was to stay
in the area of the original landing and expand it to an E.DIN
("Home of the Righteous Ones"). His task was to establish
additional setdements, each with a specific function (a space-
port, a Mission Control Center, a metallurgical center, a med-
ical center, or as landing beacons). And Ea's lot was to
organize the mining operations in southeastern Africa — a
task for which he, as an outstanding scientist, was not un-
suited.

That the task was within his competence did not mean that
Ea liked the assignment away from the Edin. So to compen-
sate him for the transfer he was given the title-name EN.KT —
"Lord of Earth."

Enlil might have thought mat it was just a gesture; Ea/
Enki, however, took the title more seriously. Though both
were sons of An, they were only half brothers. Ea/Enki was
the Firstborn Son, and normally would have followed his
father on the throne. But Enlil was a son born to Anu by a
half sister of his; and according to the succession rules on
Nibiru, that made Enlil the Legal Heir, even if not firstborn.
Now the two half brothers found themselves on another
planet, facing a potential conflict: If the mission to Earth

44 THE COSMIC CODE

would become an extended affair — perhaps even a perma-
nent colonization of another planet — who would be in su-
preme authority, the Lord of Earth or the Lord of the
Command?

The matter became an acute problem for Enki in view of
the presence on Earth of his son Marduk as well as Enlil's
son Ninurta; for while the former was born to Enki by his
official consort, the latter was born to Enlil (on Nibiru) by
the half sister Ninmah (when both were unmarried; Enlil
married Ninlil on Earth. Ninmah never married). And mat
gave Ninurta precedence over Marduk in the line of succes-
sion.

Unabashed philanderer mat he was, Enki decided to rem-
edy the situation by having sex with his half sister, too, hop-
ing also to have a son by her. The lovemaking produced a
daughter instead. Unrelenting, Enki lost no time in sleeping
with the daughter as soon as she matured; but she, too, bore
a daughter. Ninmah had to temporarily immobilize Enki to
put an end to his conjugal attempts.

Though he could not attain a son by a half sister, Enki
was not lacking other male offspring. In addition to
MAR.DUK ('"Son of the Pure Mound"), who had also come
from Nibiru, there were the brothers NER.GAL ("Great
Watcher"), GIBIL ("He of the Fire"), N1N.A.GAL
("Prince of the Great Waters"), and DUMU.ZI ("Son Who
Is Life"). It is not certain mat all of mem were in fact moth-
ered by Enki's official spouse, NIN.KI ("Lady Earth"); it is
virtually certain that the sixth son, NIN.GISH.ZID.DA
("Lord of the Artifact/Tree of Life") was me result of a
liaison between Enki and Enlil's granddaughter Ereshkigal
when she was a passenger on his ship, on the way from the
Edin to Africa. A Sumerian cylinder seal depicted Enki and
his sons (Fig. 18).

Once Enlil had married his official consort, a young nurse
who was given the epithet-name NIN.LIL ("Lady of the
Command"), he never wavered in his fidelity to her. They
had together two sons — the Moon god NANNAR ("The
Bright One"), who was later known as Sin by the Semitic-

Divine Generations

45

Figure 18

speaking peoples; and a younger son, ISH.KUR ("He of the
Mountains"), who was better known by the name Adad —
"The Beloved" son. This paucity of offspring, compared to
Enki's clan, might explain why the three children of Nannar/
Sin and his spouse, NIN.GAL ("Great Lady"), were quickly
included in the leadership of the Anunnaki, in spite of their
being three generations removed from Anu. They were the
above-mentioned ERESH.KI.GAL ("Mistress of the Great
Land") and the twins UTU ("The Shiny One") and
IN.ANNA ("An's Beloved") — the Shamash ("Sun god")
and Ishtar (Astarte/Venus) of later pantheons.

At the peak of their presence on Earth the Anunnaki num-
bered six hundred, and the texts named quite a number of
them — as often as not indicating their roles or functions. The
very first text dealing with Enki's initial splashdown names
some of his lieutenants and the tasks assigned to them. The
governors of each of the settlements established by the An-
unnaki were named, as were all ten ante-Diluvial rulers in
the Edin. The female offspring born as a result of Enki's
shenanigans were identified, as were their assigned husbands.
Recalled by name were chamberlains, and emissaries of the
principal gods, as were male and female deities in charge of
specific activities (e.g. Ninkashi, in charge of beer making).

Contrary to the total absence of a genealogy for Yahweh,
the biblical God, the Anunnaki "gods" were fully cognizant
of genealogies and the changing generations. There existed

46 THE COSMIC CODE

as part of the secret knowledge kept in temples God Lists,
in which the Anunnaki "gods" were listed in genealogical/
generational succession. Some such discovered lists named
no fewer man twenty-three Divine Couples who were the
precursors of Anu (and thus of Enlil and Enki) on Nibiru.
Some lists just named the Anunnaki gods in chronological
succession; others carefully noted the name of the divine
mother alongside the divine father's name, for who the
mother was determined the offspring's status under me Rules
of Succession.

Towering above them all was always a circle of twelve
Great Gods, me forerunner of the Twelve Olympians of the
Greek pantheon. Beginning with me Olden Gods, men
changing with the times and the generations, the composition
of the Circle of Twelve varied — but always remained twelve;
as someone dropped off, another was added instead; as some-
one had to be elevated in rank, someone else had to be
demoted.

The Sumerians depicted their gods wearing distinctive
homed caps (Fig. 19), and we have suggested mat the num-
ber of pairs of such horns reflected me numerical rank of the
deities. The ranking in the original Sumerian pantheon began
with 60 (the base number in Sumerian mathematics) for Anu,
and continued with 50 for the legal successor Enlil, 40 for
Enki, 30 for Nannar/Sin, 20 for Utu/Shamash, and 10 for
Ishkur/Adad. The female component was given the ranks 55,
45, 35, and 25 for me spouses Antu, Ninlil, Ninki. and Nin-
gal, then 15 for the unmarried Ninmah and 5 for me single
Inanna/Ishtar; reflecting the generational changes, the latter
in time attained the rank "15" and Ninmah dropped to 5.

It is noteworthy that the two contenders for me Succession
on Earth, Ninurta and Marduk, were kept off the initial
"Olympian" list. But when the contest heated up, the Coun-
cil of the Gods recognized Ninurta as the legal successor and
assigned to him me rank of 50 — me same as that of his father
Enlil. Marduk, on the other hand, was given the low rank
10.

These rankings were considered divine secrets, revealed

Divine Generations

47

Figure 19

only to selected priestly "initiates." The tablets on which
the "secret numbers of the gods" were inscribed (such as
tablet K.170 from the temple of Nineveh) contained a strict
prohibition against showing it to the la mudu'u — the "unini-
tiated." Frequently, information about the gods was recorded
without naming them by their names; instead, their secret
numbers were used, e.g. "the god 30" for Nannar/Sin.

The table in Fig. 20 identifies the Great Gods by parentage
and rank, highlighting the twelve Great Gods.

But why twelve!

The answer, we believe, lies in another major problem that
the Anunnaki faced once they changed their mission from a
one-time mineral-extracting expedition to a long-term settle-
ment with almost a thousand of them involved. From their
viewpoint, they had come from a planet with a "normal"
orbit to one that crazily runs around the Sun, orbiting the
Sun 3,600 times in one (Nibiru) year (one orbital period).
Besides the physical adjustments, there was a need somehow

48

THE COSMIC CODE

b\ — . — L
>-i --*

1

Figure 20

to relate Earthtime to Nibirutime. Establishing their sophis-
ticated equipment at Mission Control Center in Nippur (a
facility called DUR.AN.KI — "Bond Heaven-Earth'"), they
certainly became aware of the gradual retardation that we
call precession, and realized that the Earth, besides the orbital
fast year, also had another longer cycle — the 25,920 years it
took the Earth to return to the same heavenly spot, a cycle
that came to be known as the Great Year.

As depictions on cylinder seals (Fig. 21) show, the An-

Divine Generations

o ° * ° ■

49

Figure 21

unnaki considered the "family of the Sun" to consist of
twelve members: the Sun (in the center), the Moon (for rea-
sons which were given), the nine planets we know of at pres-
ent, and one more — their own planet, Nibiru. To them this
number, twelve, was a basic number to be applied in all
celestial matters affecting the Bond Heaven-Earth, including
the division of the starry circle around the Sun. Using their
detailed sky charts, they grouped the stars in each sky seg-
ment into constellations. What shall they name them? Why
not after their very own leaders?

Here was Ea, "Whose Home Is Water." who had splashed
down to Earth in the waters of the Persian Gulf, who loved
to sail the marshes in a boat, who filled the lakes with fish.
They honored him by naming accordingly two constellations,
those of the Waterman (Aquarius) and the Fishes (Pisces);
in Sumerian times, he was so depicted on cylinder seals (Fig.
22a) and the priests that oversaw his worship were dressed
as Fishmen (Fig. 22b). Enlil — forceful, strong-headed, and

50

THE COSMIC CODE

Figures 22a, 22b. and 22c

frequently compared to a bull, was honored with naming his
constellation as that of the Bull (Taurus). Ninmah, desired
but never married, had me constellation Virgo named for her.
Ninurta, often called Enid's Foremost Warrior, was honored
with the Bow — Sagittarius; Ea's firstborn, stubborn and
hardheaded, was likened to a roaming Ram (Aries). And
when the twins Utu/Shamash and Inanna/Ishtar were born, it
was only befitting mat a constellation, Gemini (the Twins),
be named in their honor. (In recognition of Enid's and Utu's
roles in the Anunnaki's space activities, me Enlilite priests
dressed as Eaglemen. Fig. 22c). As the hierarchial ranks
changed and as second- and third-generation Anunnaki
joined the scene on Earth, all the twelve zodiacal constella-
tions were assigned to Anunnaki counterparts.
Not men, but the gods, devised the zodiac.

Divine Generations 51

And the number, no matter what the changes, always had
to add up to twelve.

After forty "Repetitions" (orbits) of Nibiru since the first
arrival, the Anunnaki assigned to the gold mines mutinied.
A text called Atra Hasis describes the events that preceded
the mutiny, the mutiny itself, and its consequences. The most
important consequence was the creation of The Adam: the
text tells how Mankind was brought about. Encouraged by
Enki, the mutiny was directed primarily against Enlil and his
son NIN.UR.TA ("Lord Who Completes the Foundation").
Enlil demanded that the mutineers be given the maximum
punishment: Enki described the impossibility of continuing
the harsh toil; Anu sided with Enki. But the gold was still
needed for survival; so how would it be obtained?

At the moment of impasse, Enki sprang on the Anunnaki
leadership his astounding suggestion: Let us. he said, create
a Primitive Worker who shall be capable of doing the work!
When the amazed Council of the Gods asked how a new
being could be created, Enki explained that the being he had
in mind "already exists" — a hominid that had evolved on
Earth, but had not yet reached the evolutionary stage of the
Anunnaki. All we have to do, he said, is to "put the mark
of the gods" on them — to alter them genetically to resemble
the Anunnaki.

The discussion and the suggested solution are echoed in
the Bible:

And Elohim said:
"Let us make Man in our image
and after our likeness"

— a being that would resemble the Anunnaki both physically
and mentally. This being, Enki promised, "will be charged
with the service of the gods, that they might have their ease."
Enticed by the prospect of relief from the hard toil, the gods
agreed.

Several Sumerian texts describe how, with the help of Nin-

52

THE COSMIC CODE

Figure 23

mah and after much trial and error, a Lullu — a "Mixed
One" — was created. Satisfied that a "perfect model" had
been attained, Ninmah raised him and shouted: "My hands
have made it!"

She considered the moment to mark a momentous
event. So should we — for, in the depiction of the moment
by a Sumerian artist on a cylinder seal (Fig. 23), we are
shown the most momentous event in the annals of Man-
kind: the moment when we, Homo sapiens, emerged on
Earth.

Using the successful genetic combination, the slow process
of making duplicates — a process we now call cloning — was
started. The reproduction, involving the need for Anunnaki
females to serve as Birth Goddesses, cloned the Primitive
Worker in sets of seven males, seven females. The Bible
(Genesis chapters 1 and 5) tells it thus:

On the day that Elohim created the Adam,
in the likeness of Elohim he made him;
Male and female created he them.

Cloning was a slow process, requiring the service of the
Birth Goddesses because the new being, as a hybrid, could
not procreate on its own. So to speed it up Enki performed
a second feat of genetic engineering — but this time on his

Divine Generations 53

own initiative. Tinkering with what are now called chro-
mosomes X and Y, he gave the human race the ability to
procreate on its own. The Bible recorded the event in the
tale of Adam and Eve in the Garden of Eden (the Sumerian
E.DIN), in which Enki plays the role of the Nachash — a term
translated "serpent" but which also means "He who knows/
possesses secrets."

Though he had voted for the genetic experiment. Enlil did
so reluctantly. Unlike the great scientist Enki. he was not
carried away by the scientific challenge. Whimsically we
might even imagine him saying, "We did not come to an-
other planet to play God" ... He was infuriated when Enki
performed the second (unauthorized) genetic manipulation.
"You have made the Adam to be like one of us," able to
procreate, he shouted; one more step, and he would also par-
take of the fruit of the Tree of Life !

So Mankind was banished from the Garden of Eden, to
fend for itself; but instead of withering, it proliferated and
filled the Earth. Enid's displeasure grew when young An-
unnaki began to fraternize with the Daughters of Man, even
had children with them. In the Bible (Genesis chapter 6) the
story of me Nefilim ("Those Who Came Down"), the "sons
of the Elohim" who intermarried with human females, serves
as a preamble to the story of the Deluge, the explanation for
the decision to wipe Mankind off the face of the Earth.

Enlil put his plan before the Council of the Gods. A great
calamity, he said, is about to happen. On its next passage
Nibiru will cause a huge tidal wave that will engulf the Earth.
Let us not warn Mankind — let all flesh perish! The gods
agreed and swore to secrecy. So did Enki; but he found a
way to warn his faithful worshiper Ziusudra ("Noah" in the
Bible) and instructed him to build the Ark to save his fanuly
and friends, as well as to preserve the "seed" of living an-
imals.

The story of the Great Flood is one of the longest in the
Bible; yet as long as it is, it is but a short version of much
longer and more detailed Sumerian and Akkadian texts that

54 THE COSMIC CODE

deal with this watershed event. In its aftermath even Enlil
relented. Realizing that after everything that the Anunnaki
had built on Earth had been destroyed, they needed Mankind
as a partner to make Earth habitable again. With Enlil's con-
sent, the Anunnaki began to advance Mankind culturally and
technologically, in intervals that lasted 3,600 years (matching
the orbital period of Nibiru). The culmination of the process
was the great Sumerian civilization.

On the eve of the Deluge, the Anunnaki took to their craft
to escape the calamity, watching the havoc and total destruc-
tion from Earth's skies. Not only Mankind perished: All that
the Anunnaki had built in the past 432,000 years was wiped
off the face of the Earth or buried under miles-thick layers
of mud; and that included the spaceport they had in the
E.DIN.

As soon as the tidal wave began to recede, they could
bring their Earth-orbiting craft down on the Near East's high-
est peaks, the peaks of Ararat. As more of the dry land ap-
peared, they could use the Landing Place — a vast stone
platform that had been erected before the Rood in the Cedar
Mountains of what is now Lebanon. But to resume the space
operations they needed a spaceport: and the decision was
made to erect it in the Sinai peninsula. The Landing Corridor,
as before me Rood, was anchored on me conspicuous twin
peaks of Mount Ararat; the Landing Place was incorporated;
a new Mission Control Center (to replace the one that had
been in pre-Diluvial Nippur) was selected; and two artificial
twin peaks, to anchor the Landing Corridor's terminus, were
erected — the two still-standing great pyramids at Giza in
Egypt.

Concerned by the simmering rivalries between what has
come to look like two distinct clans on Earth, the location
of the spaceport and its auxiliary facilities assumed major
importance. To minimize frictions, the de facto division of
domains between Enlil in the Edin and Enki in the Abzu was
formalized, the former and his descendants granted dominion
over Asia and nearby parts of Europe, the latter the whole

Divine Generations 55

African continent. That meant that the pre-Diluvial Landing
Place and the new Mission Control Center were in Enlilite
territory, and the great pyramids with their intricate guidance
systems in Enki'ite hands. It was therefore resolved to place
the area of the spaceport, the Sinai peninsula, in the neutral
hands of Ninmah. To mark the event, she was given the title-
epithet NIN.HAR.SAG — "Lady of the Mountainpeaks."

Our suggestion that the gods of Egypt were none other
than Enki and his clan may seem far-fetched at first glance.
Weren't their names, to start with, entirely different? The
great Olden God of the Egyptians, for example, was called
PTAH, "The Developer"; but that was also the meaning of
Enki's Sumerian epithet NUDIMMUD, "The Maker of Art-
ful Things." He was the Knower of Secrets, the Divine Ser-
pent, in both pantheons; and (recalling his epithet "whose
home is water") was depicted in both as the Divine Water-
man (Figs. 14, 22), our Aquarius. In the Egyptian pantheon
the Mistress of the Sinai was HATHOR, nicknamed "The
Cow" in her old age; so too was Ninharsag nicknamed in
Sumer as she grew old.

Enki's principal son and successor in Egypt was RA, "The
Pure One," paralleling Marduk, "Son of the Pure Mound,"
in Mesopotamia. The many other similarities between the
two have been expounded in The Wars of Gods and Men.
So were the reasons for identifying me Egyptian god
THOTH, a son of Ptah and keeper of divine secret knowl-
edge, as the god Ningishzidda of the Sumerian texts.

In time Ptah/Enki handed over the reign over Egypt to his
son Marduk/Ra; but the latter was not appeased. Reign over
the whole Earth was his birthright, he kept asserting; and that
led to conflicts with the Enlilites that we described as the
Pyramid Wars. At one time — circa 8700 B.C. by our calcu-
lations — he was forced to leave Egypt; according to Manetho
(an Egyptian priest who wrote down me history and prehis-
tory of Egypt in Greek times) the reign was then assigned to
Marduk's brother Thoth. Where did Marduk/Ra go? The pos-
sibility that he was sent back to Nibiru (the Egyptians called
it Planet of Millions of Years) cannot be ruled out. An an-

56 THE COSMIC CODE

cient Egyptian text recorded in pharaonic tombs, called The
Assignment of Functions to Thoth, has Ra transferring pow-
ers to Thoth and designating Thoth as "Thoth, the Place
Taker." "Thou shall be in my place," Ra announces, "a
Place Taker." Explaining where he is, Ra tells Thoth: "I
am here in the sky, in my proper place." The fact that one
segment of the absence, that of demigods, lasted 3,650
years — almost exactly the average 3,600 years of Nibiru's
orbit — strongly suggests that that is where Ra/Marduk spent
his absence from Earth. Texts, both Egyptian and Mesopo-
tamian, that describe a tough space journey that became es-
pecially perilous near Saturn, may well have dealt with Ra/
Marduk's return voyage to Earth.

The returning Ra/Marduk found an Earth that he could
hardly recognize. In the intervening period, the Sumerian
civilization had burst into full bloom. There, in addition to
the expansion of the headquarters of Enlil and Enki into sa-
cred precincts surrounded by teeming cities (Nippur and Er-
idu, respectively), Cities Of Man had been established. The
newly created institution of Kingship was inaugurated in a
new city, Kish, under the aegis of Ninurta. Nannar/Sin was
given mastery over a new urban center called Ur. A sacred
precinct built for a visit of Anu and Antu was expanded to
become the city of Uruk (the biblical Erech) and was given
as a gift to Inanna/Ishtar. The functions of the Priesthood
were formalized; a calendar — the famed Calendar of Nip-
pur — was introduced, based on sophisticated astronomical
knowledge and official festivals. Started in 3760 B.C., it is
still in use as the Hebrew calendar.

The returning Marduk must have cried out to his father
and the Council of the Gods: And what about me?

He set his sights on a place not far from where the pre-
Diluvial spaceport had been, and determined to make it into
a Bab-lli — "Gateway of the Gods" (hence its lasting name
Babylon). It was to be a symbolic and actual expression of
his supremacy.

What ensued is recalled in the Bible as the incident of the
Tower of Babel; it took place in Shine'ar (the biblical name

Divine Generations

57

41 fl

1KI

fri

•Lhlfe

5ffi8W

*- < - - '

mm)

Figures 24a, 24b, and 24c

for Sumer). There the followers of the god of Babylon began
to build "a tower whose head can reach the heavens" — a
launch tower, we would say nowadays. "Let us make us a
Shem." they said — not a "name" as is commonly translated,
but the original meaning of the Sumerian source of the word
MU — a rocketlike object. The time, by our calculations, was
3450 B.C.

Descending from the skies, the leader of the Elohim or-
dered the tower destroyed. Both the biblical version and the
Mesopotamian texts report that it was in the aftermath of this
incident that the Elohim decided to "confuse Mankind's lan-
guage," to prevent Mankind from acting in unison. Until
then "there was one language and one kind of words upon
the whole Earth" (Genesis 11:1). Until then there was indeed
one civilization, that of Sumer, with a single language and
form of writing (Fig. 24a). In the aftermath of the incident
at Babylon, a second civilization, the Nile Civilization
(Egypt and Nubia), was established, with its own language

58 THE COSMIC CODE

and script (Fig. 24b); and several centuries later, the third
civilization, that of the Indus Valley, was begun with its own
language and script (Fig. 24c), a script that is still undeci-
phered. Thus was Mankind aliened three Regions; the Fourth
Region was retained by the gods: the Sinai peninsula, where
the spaceport was.

Defied in Mesopotamia, Ra/Marduk returned to Egypt to
reassert his supremacy there, as the Great God of the new
civilization. The time was 3100 B.C. There was, of course,
the small problem of what to do with Thoth, who had been
the reigning deity in Egypt and Nubia while Ra/Marduk was
gone. Unceremoniously, he was sent away ... In The Lost
Realms we have suggested that, taking along a group of his
African followers, he went all the way to the New World, to
become Quetzalcoatl, the Winged Serpent god. The first cal-
endar instituted by him in Mesoamerica (the Long Count
calendar) began in the year 3113 B.C.; it was, we believe, the
precise date of the arrival in the New World of Thotii/Quet-
zalcoatl.

Still seedling from his failure in Mesopotamia, the bitter
Marduk turned to settling other scores. During his absence a
divine '"Romeo and Juliet" — his brother Dumuzi and In-
anna/Ishtar, the granddaughter of Enlil — fell in love and
were to be betrothed. The union was anathema to Ra/Mar-
duk; he was especially alarmed by Inanna's hopes to become
Mistress of Egypt through the marriage. When Marduk's em-
issaries tried to seize Dumuzi, he accidentally died as he tried
to escape. His death was blamed on Marduk.

Texts that have been discovered in several copies and ver-
sions provide details of the trial of Marduk and his punish-
ment: to be buried alive in the Great Pyramid, which was
sealed tight to create a divine prison. With only air to breathe
but no food or water, Marduk was sentenced to die in that
colossal tomb. But his spouse and mother successfully ap-
pealed to Anu to commute the death sentence into one of
exile. Using the original construction plans, an escape shaft
was dug and blasted into the passages above the massive
plugs. The return of Marduk from certain death, his emer-

Divine Generations 59

gence from his tomb, were aspects of the view that the
texts — titled by early translators "The Death and
Resurrection of the Lord" — were precursors of the New Tes-
tament tale of the death, entombment, and resurrection of
Jesus.

Sentenced to exile, Ra/Marduk became Amen-Ra, the un-
seen god. This time, however, he roamed the Earth. In an
autobiographical text in which his return was prophesied,
Marduk described his wanderings thus:

I am the divine Marduk, a great god.

I was cast off for my sins.

To the mountains I have gone,

in many lands I have been a wanderer.

From where the sun rises

to where it sets I went.

And wherever he roamed, he kept asking the Gods of Fate:
"Until when?"

The answer regarding his Fate, he realized, came from the
heavens. The Age of the Bull, the age zodiacally belonging
to Enlil and his clan, was ending. The dawn was nearing
when the Sun would rise on the first day of spring, the day
of the New Year in Mesopotamia, in the zodiacal constel-
lation of the Ram (Aries) — his constellation. The celestial
cycle of Fates augurs his, Marduk's, supremacy!

Not everyone agreed. Was it just so because of time cal-
culations, or an observable celestial phenomenon? Marduk
could not care less; he launched a march on Mesopotamia
while his son, Nabu, organized followers to invade the Sinai
and seize the spaceport. The escalating conflict is described
in a text known as the Erra Epos; it tells how, seeing no
other choice, the gods opposing Marduk used nuclear weap-
ons to obliterate the spaceport (and, as a sideshow, the un-
faithful cities of Sodom and Gomorrah).

But Fate intervened on the side of Marduk. The prevailing
western winds carried the deathly nuclear cloud eastward,
toward Sumer. Babylon, farther north, was spared. But in

60 THE COSMIC CODE

southern Mesopotamia the Evil Wind caused sudden death
and lasting desolation. Sumer's great capital, Ur, was a place
where wild dogs roamed.

And so, in spite of the extraordinary efforts of Marduk's
opponents, the Age of the Ram indeed ushered in the rise of
Babylon.

BETWEEN FATE
AND DESTINY

Was it Fate, or was it Destiny, that led Marduk by an unseen
hand through all his troubles and tribulations over many mil-
lennia to his final goal: supremacy on Earth?

Not many languages have such a choice of words for that
"something" that predetermines the outcome of events be-
fore they happen, and even in the English language many
would be hard put to explain the difference. The best dic-
tionaries (such as Webster's) explain the one term by the
other, regarding as synonyms for bom "doom," "lot." and
"fortune." But in the Sumerian language, and thus in Su-
merian philosophy and religion, mere was a clear distinction
between the two. Destiny, NAM, was the predetermined
course of events that was unalterable. Fate was NAM. TAR —
a predetermined course of events that could be altered: lit-
erally, TAR, to cut, break, disturb, change.

The distinction was not a matter of mere semantics; it went
to the core of tilings, affecting and dominating the affairs of
gods and men, lands and cities. Was something that was
about to happen, even something that had happened — a Des-
tiny, the outcome (and, if you will, the destination to which
it leads) unalterable; or was it a combination of chance
events, or willed decisions, or temporary ups or downs that
might or might not be fatal, that another chance event or a
prayer or a change in a lifestyle might, lead to a different end
result? And if the latter, what might have been different?

The fine line distinguishing between the two may be
blurred today, but it was a difference well-defined in Su-
merian and biblical times. For the Sumerians, Destiny began

61

62 THE COSMIC CODE

in the heavens, starting with the preordained orbital paths of
the planets. Once the Solar System begot its shape and com-
position after the Celestial Battle, the planetary orbits became
everlasting Destinies; the term and concept could then be
applied to the future course of events on Earth, starting with
the gods who had celestial counterparts.

In the biblical realm, it was Yahweh who controlled bom
Destinies and Fates, but while me former was predetermined
and unalterable, the latter (Fate) could be affected by human
decisions. Because of the former powers, the course of future
events could be foretold years, centuries, and even millennia
earlier, as when Yahweh revealed to Abraham the future of
his descendants, including the sojourn of four hundred years
in Egypt (Genesis 15:13-16). How that sojourn would come
about (it began with a search for food during a great famine)
was a matter of Fate; that the sojourn would begin with an
unexpected welcome (because Joseph, through a series of
consecutive occurrences, became Overseer over all of Egypt)
was a matter of Fate; but that the sojourn (after a period of
enslavement) would end with a liberating Exodus at a pre-
determined time was a Destiny, preordained by Yahweh.

Because they were called to prophecy by God, the biblical
prophets could foretell the future of kingdoms and countries,
of cities and kngs and individuals. But they made it clear
that their prophecies were merely expressions of divine de-
cisions. 'Thus sayeth Yahweh, Lord of Hosts," was a fre-
quent way in which the Prophet Jeremiah began as the future
of kingdoms and rulers was foretold. "So sayeth the Lord
Yahweh." the Prophet Amos announced.

But when it came to Fates, the free will and free choice
of people and nations could come and did come into play.
Unlike Destinies, Fates could be changed and punishments
could be averted if righteousness replaced sin, if piety re-
placed profanity, if justice prevailed over injustice. "It is not
the death of the evildoer that I seek, but that the wicked shall
turn from his ways and live," the Lord God told the Prophet
Ezekiel (33:11).

The distinction made by the Sumerians between Fate and

Between Fate and Destiny 63

Destiny, and how they can both play a role even in the life
of a single individual, becomes apparent in the life story of
Gilgamesh. He was, as we have mentioned, the son of Uruk's
high priest and the goddess Ninsun. As he grew older and
began to contemplate issues of life and death, he posed the
question to his godfather, the god Utu/Shamash:

In my city man dies; oppressed is my heart.
Man perishes, heavy is my heart.. .
Man, the tallest, cannot stretch to heaven;
Man, the widest, cannot cover the Earth.
Will I too 'peer over the wall'?
Will I too be fated thus?

The answer of Utu/Shamash was not encouraging. "When
the gods created Mankind," he said, "death to Mankind they
allotted; Life they retained in their own keeping." This is
your Destiny; so, while you are alive and what you do in the
meantime is a Fate that you can change or affect, enjoy it
and make the most of it —

Let full he thy belly, Gilgamesh;
Make thou merry by day and night!
Of each day. make a feast of rejoicing;
Day and night, dance thou and play!
Let thy garments be sparkling fresh.
Bathe in water, let thy head be washed.
Pay heed to the little one who holds thy hand.
Let thy spouse delight in your bosom.
This is the fate of Mankind.

Receiving this answer, Gilgamesh realized that what he
must do is take some drastic action to change his Destiny,
not merely his Fate; otherwise, he would meet the same end
as any mortal. With his mother's reluctant blessing, he em-
barked on the journey to the Landing Place in the Cedar
Mountains, mere to join the gods. But Fate intervened, again
and again. First it was in the shape of Huwawa, the robotic

64 THE COSMIC CODE

guardian of the Cedar Forest, then through the lusting of
lnanna/Ishtar for the king and the rebuff that led to the slay-
ing of the Bull of Heaven. The role of Fate — Namtar — was
recognized and considered by Gilgamesh and his companion
Enkidu right then, even right after the slaying of Huwawa.
The epic text relates how the two comrades sit and contem-
plate the expected punishment. As the actual slayer. Enkidu
ponders what his fate will be. Gilgamesh comforts him:
Worry not, he says; the "Adjurer" Namtar indeed can de-
vour — but he also "lets the caught bird go back to its place,
lets the caught man return to the bosom of his mother."
Falling into the hands of Namtar is not an unalterable oc-
currence; as often as not, Fate reverses itself.

Refusing to give up, Gilgamesh embarked on a second
journey, this time to the spaceport in the Sinai peninsula. His
troubles and tribulations on the way were coundess, yet he
persevered. At last he managed to obtain the fruit that would
have given him eternal youth; but in the end a serpent
snatched it from him as the weary Gilgamesh fell asleep, and
he returned to Uruk empty-handed, there to die.

A series of What if? questions naturally come to mind.
What if things had gone differently in the Cedar Mountains —
would Gilgamesh have succeeded to ascend heavenward and
join the gods on their planet? What if he had not fallen asleep
and kept the Plant of Everlasting Youth?

A Sumerian text titled by scholars The Death of Gilgamesh
provides an answer. The end, it explains, was preordained;
there was no way that Gilgamesh, taking his Fate into his
own hands over and over again, could have changed his Des-
tiny. The text provides this conclusion by reporting an omen-
dream of Gilgamesh that contained a prediction of his end.
Here is what Gilgamesh is told:

O Gilgamesh.

this is the meaning of the dream:

The great god Enlil, father of the gods,

had decreed thy destiny.

Between Fate and Destiny 65

Thy fate for kingship he determined;
For eternal life he has not destined thee.

The Fate of Gilgamesh, he is told, has been overridden by
Destiny. He was fated to be a king; he was not destined to
avoid death. And so destined, Gilgamesh is described dying.
"He who was firm of muscle, lies unable to rise ... He who
had ascended mountains, lies, rises not." "On the bed of
Namtar he lies, rises not."

The text lists all the good happenings that Gilgamesh had
experienced — kingship, victories in battle, a blessed family,
faithful servants, beautiful garments; but recognizing me in-
terplay of Fate and Destiny, concludes by explaining to Gil-
gamesh: Both "the light and the darkness of Mankind were
granted to thee." But in the end, because Destiny has over-
ridden Fate, "Gilgamesh, the son of Ninsun, lies dead."

The What if? question can be expanded from one individ-
ual to Mankind as a whole.

What would have been the course of events on Earth (and
elsewhere in the Solar System) were Ea's original plan to
obtain gold from the waters of the Persian Gulf to succeed?
At a crucial turn of events, Anu, Enlil, and Ea drew lots to
see who would rule Nibiru, who would go to the mines in
southeast Africa, who would be in charge of the expanded
Edin. Ea/Enki went to Africa and, encountering there the
evolving hominids, could tell the gathered gods: The Being
that we need, it exists — all that we have to do is put on it
our genetic mark!

The Atra Hasis text, brought together from several ren-
ditions and many fragments by W. G. Lambert and A. R.
Millard, described the fateful moment thus:

The gods had clasped hands together,
had cast lots and hud divided.

Would the feat of genetic engineering have taken place
had either Anu or Enlil been the one to go to southeastern
Africa?

66 THE COSMIC CODE

Would we have shown up on our planet anyway, through
evolution alone? Probably — for that is how the Anunnaki
(from the same seed of life!) had evolved on Nibiru, but far
ahead of us. But on Earth we came about through genetic
engineering, when Enki and Nimah jumped the gun on ev-
olution and made Adam the first "test tube baby."

The lesson of the Epic of Gilgamesh is that Fate cannot
change Destiny. The emergence of Homo sapiens on Earth,
we believe, was a matter of Destiny, a final outcome that
might have been delayed or reached otherwise, but undoubt-
edly reached. Indeed, we believe mat even though me An-
unnaki deemed their coming to Earth their own decision for
their own needs, that too, we believe, was preordained, des-
tined by a cosmic plan. And equally so, we believe, will be
Mankind's Destiny: to repeat what the Anunnaki had done
to us by going to another planet to start the process all over
again.

One who understood the connection between Fate and the
twelve zodiacal constellations was Marduk himself. They
constituted what we have termed Celestial Time, the link
between Divine Time (the orbital period of Nibiru) and
Earthly Time (the Year, months, seasons, days, and nights
resulting from the Earth's orbit, tilt, and revolution about its
own axis). The heavenly signs that Marduk had invoked —
the arrival of the Zodiacal Age of the Ram — were signs in
the realm of Fate. What he needed to solidify his supremacy,
to eliminate from it the notion that, as Fate, it could be
changed or revised or reversed, was a Celestial Destiny. And
to that aim he ordered what can be considered the most au-
dacious falsification ever.

We are talking about the most sacred and basic text of the
ancient peoples: the Epic of Creation, the core and bedrock
of their faith, religion, science. Sometimes called by its open-
ing lines Enuma elish (When in the Heights of Heaven), it
was a tale of events in the heavens that involved celestial
gods and a Celestial Battle, the favorable outcome of which
made possible all the good things on Earth, including the

Between Fate and Destiny

67

Figure 25

coming into being of Mankind. Without exception me text
was viewed by the scholars who began to piece it together
from many fragments as a celestial myth, an allegory of the
eternal fight between good and evil. The fact that wall sculp-
tures discovered in Mesopotamia depicted a winged (i.e. ce-
lestial) god fighting a winged (i.e. celestial) monster (Fig.
25) solidified the notion that here was an ancient forerunner
of the tale of St. George and the Dragon. Indeed, some of
the early translations of the partial text titled it Bel and the
Dragon. In those texts, the Dragon was called Tiamat and
Bel ("the Lord") was none other than Marduk.

It was only in 1876 that George Smith, working in the
British Museum on piecing together fragments of inscribed
clay tablets from Mesopotamia, published the master work
The Chaldean Genesis that suggested the existence of a Bab-
ylonian story that paralleled the creation parts of Genesis in
the Bible; and then the Museum's Keeper of Babylonian An-
tiquities, L. W. King, followed with the authoritative work
The Seven Tablets of Creation to establish conclusively the
correlation between the biblical seven days of creation and
the earlier Mesopotamian sources.

But if that was the case, how could the Babylonian text
still be called an allegory? For doing so would also catego-

68 THE COSMIC CODE

rize the tale in Genesis as an allegory and not an unalterable
Divine Act that has been a bedrock of monotheism and
Judeo-Christian beliefs.

In our 1976 book The Twelfth Planet we have suggested
that neither the Mesopotamian text nor its condensed biblical
version was myth or allegory. They were based, we sug-
gested, on a most sophisticated cosmogony that, based on
advanced science, described the creation of our Solar System
stage by stage; and then the appearance of a stray planet from
outer space that was gradually drawn into our Solar System,
resulting in a collision between it and an olden member of
the Sun's family. The ensuing Celestial Battle between the
invader — "Marduk" — and the olden planet — Tiamat — led
to the destruction of Tiamat. Half of it broke up into bits and
pieces that became a Hammered Bracelet; the other half,
shunted to a new orbit, became the planet Earth, carrying
with it Tiamat's largest satellite that we call the Moon. And
the invader, attracted into the center of our Solar System and
slowed down by the collision, became permanently the
twelfth member of our Solar System.

In the subsequent companion book Genesis Revisited
(1990), we showed that all the advances in our celestial
knowledge corroborated the Sumerian tale — a tale which ex-
plained satisfactorily the history of our Solar System, the
enigma of Earth's continents starting only on one side with
an immense gap (me Pacific basin) on the other side, the
origin of the Asteroid Belt and the Moon, the reason for
Uranus lying on its side and Pluto having an odd orbit, and
on and on. The extra knowledge we have gained through the
study of comets, the use of the Hubble telescope, and the
probes of the Moon (manned) and other planets in our Solar
System (by unmanned spacecraft) continue to corroborate the
Sumerian data as we have understood it.

By calling the cosmogony underlying the Epic of Creation
Sumerian, rather than Babylonian, we provide a clue to the
true source and nature of the text. The discovery of fragments
of an earlier Sumerian version of Enuma elish convinced
scholars that the Epic of Creation was originally a Sumerian

Between Fate and Destiny 69

text, in which the invading planet was called N1B1RU, not
"Marduk." They are now convinced that the extant Baby-
lonian version was a deliberate forgery, intended to equate
the Marduk who was on Earth with the celestial/planetary
"god" who changed the makeup of our heavens, gave our
Solar System its present shape, and — in a manner of speak-
ing — created the Earth and all mat was on it. That included
Mankind, for according to the Sumerian original version it
was Nibiru, coming from some other part of the universe,
that brought with it and imparled to Earth during the colli-
sion the "Seed of Life."

(For that matter, it should be realized that the illustration
so long deemed to represent Marduk battling the Dragon is
also all wrong. It is a depiction from Assyria, where the
supreme god was Ashur, and not Babylon; the deity is de-
picted as an Eagleman, which indicates an Enlilite being; the
divine cap he wears has three pairs of horns, indicating the
rank of 30, which was not Marduk's rank; and his weapon
is the forked lightning, which was the divine weapon of Ish-
kur/Adad, Enid's — not Enki's — son.)

No sooner did Marduk seize the sovereignty in Babylon,
than the pivotal New Year rites were changed, to require the
public reading (on the festival's fourth evening) of Enuma
elish in its new, Babylonian, version; in it the supremacy of
Marduk on Earth only paralleled his supremacy in the heav-
ens, as the planet with the greatest orbital path, the one mat
embraces all the others in its loop.

The key to this distinction was the term "Destiny." That
was the term used to describe the orbital paths. The ever-
lasting, unchanging orbit was a planet's Destiny; and mat is
what Marduk was granted according to Enuma elish.

Once one realizes that this is the meaning and significance
of the ancient term for "orbits," one can follow me steps
by which the Destiny was attained by Marduk. The term is
used, for the first time in the text, in connection with the
principal satellite of Tiamat (which the text calls Kingu). At
first it is only one of Tiamat's eleven satellites (moons); but
as it "grows in stature," it becomes the "leader of her host."

70 THE COSMIC CODE

Once the only large planet and a consort of Apsu (the Sun),
Tiamat "grew haughty" and was not too pleased to see other
celestial gods appear in pairs: Lahmu and Lahamu (Mars and
Venus) between her and the Sun (where there had been be-
fore only the Sun's messenger Mummu/Mercury), and the
pairs Kishar and Anshar (Jupiter and Saturn, the latter with
his messenger Gaga/Pluto); then Anu and Nudimmud (Ura-
nus and Neptune). Tiamat and her group of moons on the
one hand and the new planets on the other hand, in a still
unstable Solar System, begin to encroach on each other's
domains. The others get especially concerned when Tiamat
"unlawfully" extends to Kingu, her largest satellite, the priv-
ileged status of having an orbit of his own — of becoming a
full-fledged planet:

She has set up an Assembly...

She has borne monster-gods;

Withal eleven of this kind she has brought forth.

From among the gods who formed her Assembly

she has elevated Kingu, her firstborn,

made him chief among the gods;

She exalted Kingu, in their midst made him great...

She gave him a Tablet of Destinies,
she fastened it upon his chest, [saying:]
"Now the command shall never be altered,
the decree shall be unchangeable!"

Unable to withstand the "raging host" of Tiamat by them-
selves, the celestial gods see salvation coming from outside
the Solar System. As was the case when The Adam was
created when an impasse was faced, so was it in the pri-
mordial heavens: It was Ea ("Nudimmud," the "Artful Cre-
ator" in Sumerian) who brought off me saving creature. As
the outermost planet, facing the "Deep" — outer space — he
attracts a stranger, a new planet. Passing in the vicinity of
our Solar System as a result of a catastrophe, a cosmic ac-

Between Fate and Destiny 71

cident far out, the new planet is the result of Fate, and does
not yet orbit our Sun — he has no Destiny as yet:

In the Chamber of Fates,

the Hall of Designs,

Bel. most wise, wisest of the gods,

was engendered;

In the heart of the Deep was the god created.

It is noteworthy that the newly arrived planet, a celestial
god, is called even in the Babylonian rendition Bel, "The
Lord," and in the Assyrian version the word "Bel" is re-
placed by the word "Ashur." The Babylonian version — the
most commonly used nowadays — repeats however the last
line, and in this second time renders it: "In the heart of the
pure Deep was Marduk created," the addition of the word
pure intended no doubt to explain the origin of the name
MAR.DUK, "Son of the Pure Place." (This double rendition
is one of the clues exposing the falsification).

Beyond Ea (Neptune), Anu (Uranus) welcomed the in-
vader. The increasing gravitational pull made the invader
sprout four moons, as well as pull him more to the Solar
System's midst. By the time it reached Anshar (Saturn), and
sprouted three more moons, the invader was already inexo-
rably caught in the Sun's gravitational pull. His course
curved inward (Fig. 26), starting to form an orbital path
around the Sun. The invader, in other words, was envisioning
a Destiny for himself!

Once he was "kissed" by Anshar/Saturn,

The gods, his forebears,

the destiny of Bel then determined:

They set him on the path,

the way to success and attainment.

The path thus ordained for him. Bel found out. was set on
a collision course with Tiamat. He was willing to accept the

72

THE COSMIC CODE

Figure 26

challenge but on a condition. Becoming now Marduk (both
celestial and on Earth), he said to Anshar:

Lord of the gods,

determiner of the great gods' destinies:

If I am indeed to be your Avenger,

to vanquish Tiamat and save your lives,

convene the divine Assembly.

proclaim supreme my Destiny!

The celestial gods accepted Marduk's conditions. "For
Marduk, their Avenger, they decreed a destiny;'" and that
Destiny, that orbit, "shall be unequaled." Now then, they
said — go and slay Tiamat!

The ensuing Celestial Battle is described in the fourth tab-
let of Enuma elish. Unavoidably set on a collision course,
Marduk and Tiamat cast lightnings, blazing flames, and grav-
itational nets against each other, "shaking with fury." As
they neared each other — Tiamat moving like all planets in a
counterclockwise direction, Marduk onrushing in a clockwise
path — it was one of Marduk's satellite moons that struck

Between Fate and Destiny

73

Figure 27

Tiamut first; then another and another of his moons struck
Tiamat — "tearing into her insides, splitting her up." A "di-
vine lightning," an immense electrical bolt, then shot out
from Marduk into the fissure, and "the life-breath of Tiamat
extinguished."

The intact Marduk swept by, made an orbital round, and
returned to the site of the battle. This time he himself struck
Tiamat with far-reaching consequences. One half of her he
smashed into bits and pieces to become the Great Band (the
Asteroid Belt); the other half, struck by Marduk's moon
named North Wind, was shunted to a" new place in the heav-
ens, to become Earth in a new orbital path. Its Sumerian
name, KI (from which the Akkadian/Hebrew "Gei" and the
Greek "Gaea" come) meant "the cleaved one" (Fig. 27).

As Tiamat's own moons were dispersed — many changing
direction to clockwise (retrograde) orbits — a special fate was

74 THE COSMIC CODE

determined by Marduk for the largest of Tiamat's moons,
Kingu:

He took from him the Tablet of Destinies,

not rightfully Kingu's.

sealed it with a seal

and fastened it to his own breast.

Now, finally, Marduk had obtained a permanent, unalter-
able Destiny — an orbital path that, ever since, has kept bring-
ing the erstwhile invader again and again to the site of the
Celestial Battle where Kingu had once been. Together with
Marduk, and counting Kingu (our Moon) for it had possessed
a Destiny, the Sun and its family reached the count of twelve.

It was this count, we suggest, that determined twelve
to be the celestial number, and thus the twelve stations
("houses") of the zodiac, twelve months of the year,
twelve double-hours in a day-night cycle, twelve tribes of
Israel, twelve apostles of Jesus.

The Sumerians considered the abode (called "cult center"
by most scholars) of Enlil as the Navel of the Earth, the place
from which other key locations were equidistant, the epicen-
ter of concentric divinely ordained sites. Best known by its
later Akkadian/Semitic name Nippur, its Sumerian name was
NIBRU.KI — "The Place of the Crossing," representing on
Earth the Celestial Place of Crossing, the site of the Celestial
Battle to which Nibiru keeps returning every 3,600 years.

Functioning as a Mission Control Center, Nippur was the
site of the DUR.AN.KI, the "Bond Heaven-Earth" from
which the space operations of the Anunnaki were controlled,
and at which the sky-maps, and all the formulas concerning
the celestial motions of the members of our Solar System
and the tracking of Divine Time, Celestial Time, and Earthly
Time and their interrelationships, were maintained and cal-
culated.

This tracking of what was deemed to be unalterable orbital

Between Fate and Destiny 75

paths was conducted with the aid of the Tablets of Destinies.
We can glimpse their functions and the sacred chamber
where they whirred and hummed by reading what happened
when their operation had come to a sudden halt. The Su-
merian text describing that, named by translators The Myth
of Zu, deals with the scheming of the god Zu (his full name,
later discoveries revealed, was AN.ZU — "The Knower of
Heavens") to usurp the Bond Heaven-Earth by seizing and
carrying off the Tablets of Destinies. Everything came to a
standstill; "the lighted brightness petered out; silence pre-
vailed"; and in the heavens those who manned the shuttle-
craft and spacecraft, "the Igigi, in space, were confounded."
(The epic tale ends with the overpowering of Zu by Enlil's
son Ninurta, the reinstallation of the Tablets of Destinies in
the Duranki, and the execution of Zu).

The distinction between an unalterable Destiny and a Fate
that could be altered or averted was expressed in a two-part
Hymn to Enlil, that described both his powers as a decreer
of Fates and as a pronouncer of Destinies:

Enlil:

In the heavens he is the Prince,

On Earth he is the Chief.

His command is far-reaching.

His utterance is lofty and holy;

The shepherd Enlil decrees the Fates.

Enlil:

His command in the heights made the heavens tremble,

down below he made the Earth quake.

He pronounces destinies unto the distant future.

His decrees are unchangeable.

He is the Lord who knows the destiny of the Land.

Destinies, the Sumerians believed, were of a celestial na-
ture. As high-ranking as Enlil was, his pronouncements of
unalterable Destinies were not the result of his own decisions
or plans. The information was made known to him; he was

76 THE COSMIC CODE

a "lord who knows the Destiny of the land," he was a
"trustworthy called-one" — not a human prophet but a divine
prophet.

That was quite different from the instances when — in con-
sultation with other gods — he decreed Fates. Sometimes he
consulted just his trusted vizier, Nusku:

When in his awesomeness he decrees the fates —
his command, the word that is in his own heart —
to his exalted vizier, the chamberlain Nusku,
does he make known, him he consults.

Not only Nusku, Enlil's chamberlain, but also his spouse
Ninlil is depicted in this hymn as participating in deciding
Fates:

Mother Ninlil, the holy wife,

whose words are gracious...

The eloquent one whose speech is elegant,

has seated herself by your side...

She speaks eloquently with you,

whispers words at your side,

decrees the fates.

Fates, the Sumerians believed, were made, decreed and
altered on Earth; and in spite of the hymnal words of ado-
ration or minimal consultation, it appears that me determi-
nation of Fates — including that of Enlil himself — was
achieved by a process that was more democratic, more akin
to that of a constitutional monarchy. The powers of Enlil
seemed to stem not only from above, from Anu and Nibiru,
but also from below, from an Assembly of the Gods (a kind
of parliament or congress). The most crucial decisions — fate-
ful decisions — were made at a Council of the Great Gods, a
kind of Cabinet of Ministers where discussions sometimes
became debates and as often as not turned into heated ex-
changes ...

The references to the Council and the Assembly of the

Between Fate and Destiny 77

Anunnaki gods are numerous. The creation of The Adam was
a subject so discussed; so was the decision to wipe Mankind
off the face of the Earth at the time of the Deluge. The latter
clearly states that "Enlil opened his mourn to speak and ad-
dressed the Assembly of the gods." The suggestion to an-
nihilate Mankind was opposed by Enki, who, having failed
to sway the assembly, "got fed up with the sitting in the
Assembly of the Gods." We read that later on, as the gods
were orbiting the Earth in their spacecraft, observing the
havoc down below, Ishtar bewailed what she saw and won-
dered how she could have voted for the annihilation of Man-
kind: "How could 1, in the Assembly of the Gods, I myself
give evil counsel?"

And after the Deluge, when the remnants of Mankind be-
gan to fill the Earth again and the Anunnaki started to give
Mankind civilization and institute Kingship as a way to deal
with the growing human masses,

The great Anunnaki who decree Fates

sat exchanging their counsels regarding the land.

This manner of determining Fates was not limited to the
affairs of Man; it also applied to the affairs of me gods them-
selves. Thus, when Enlil, in the early times of arrival on
Earth, took a liking to a young Anunnaki female and had
sex with her over her objections, Enlil was sentenced into
banishment first by "the fifty Senior Gods sitting in assem-
bly," and then by the "Fate-decreeing gods, the seven of
them."

Such was the manner, according to the Babylonian version
of Enuma elish, that the Destiny of Marduk, to be supreme
on Earth (and in the celestial counterpart), was confirmed. In
that text the Assembly of the Gods is described as a gathering
of Senior Gods, coming from various places (and perhaps
not only from Earth, for in addition to Anunnaki the dele-
gates also included Igigi). The number of those gathered was
fifty — a number matching the numerical rank of Enlil. In the
Akkadian texts they were designated as Hani rabuti sha mu-

78 THE COSMIC CODE

shimu shimati — "Senior/Great Gods who determine Fates."

Describing how such Senior Gods gathered to proclaim
Marduk's supremacy, Enuma elish paints a scene of cama-
raderie, of friends who had not seen each other for quite
some time. They arrived at a special Place of Assembly;
"they kissed one another... There was conversation; they
sat down to banquet; they ate festive bread, they drank choice
wine." And then the camaraderie turned solemn as the
"Seven Gods of Destiny" entered the Assembly Hall and
sat down to start the business at hand.

For unexplained reasons, Marduk was tested for his mag-
ical powers. Show us, the gathered Anunnaki said, how you
"can command to destroy as well as command to create!"

They formed a circle and "placed in it the images of the
constellations." The term, Lamashu, undoubtedly means the
images/symbols of the zodiac. "Open dry mouth," they said,
"let me images vanish! Speak again, and let the constella-
tions reappear!"

Obliging, Marduk performed the miracle:

He spoke, and the constellations vanished;
He spoke again, and the images were restored.

When the gods, his elders,
saw the power of his utterance,
they rejoiced, they proclaimed:
' 'Marduk is supreme!

"They bestowed on him the scepter, the throne and the
royal robe" — a most resplendent robe, as Babylonian depic-
tions showed (Fig. 28). "From this day," they announced,
"dry decree shall be unrivaled, dry command as that of Anu
... No one among the gods shall transgress thy boundaries."

While the Babylonian text suggests that the supremacy of
Marduk was tested, confirmed, and pronounced in one ses-
sion, other texts that concern the decision-making process
suggest that the Assembly stage at which fifty Senior Gods
participated was followed by a separate stage of a meeting

Between Fate and Destiny

79

Figure 28

of the Seven Great Gods Who Judge; and then the actual
pronouncement of the decision, of the Fate or the Destiny,
was made by Enlil in consultation with or after approval by
Anu. Indeed, the need for this stage-by-stage procedure and
the final pronouncement by Enlil in behalf of Anu was rec-
ognized even by the followers of Marduk. The renowned
Babylonian king Hammurabi, in the preamble to his famous
law code, exalted the supremacy of his god Marduk with
these words:

Lofty Anu,

Lord of the gods who from heaven to Earth came,

and Enlil, Lord of heaven and Earth

who determines the destinies of the land,

Determined for Marduk. the firstborn of Enki,

the Enlil-functions over all mankind.

Such a transfer of Enid's authority to Marduk, the Baby-
lonian texts asserted, was executed and symbolized by the

80 THE COSMIC CODE

bestowal on Marduk of the fifty names. The last and most
important of the power-names bestowed on him was that of
Nibiru — the very name of the planet whom the Babylonians
renamed Marduk.

Assemblies of the gods were sometimes called not to pro-
claim new Fates, but to ascertain what had been determined
at an earlier time, on the Tablets of Destinies.

Biblical statements reflect not only the royal custom of
writing things down on a scroll or tablet and men sealing the
document as preserved evidence; the custom was attributed
to (and undoubtedly learned from) me gods. The culmination
of those references is found in me Song of Moses, his tes-
tament and prophecy before he died. Extolling me almighty
Yahweh, and his capacity to proclaim and foresee Destinies.
Moses quotes the Lord as saying of me future:

Lo and behold:

It is a secret with me hidden.

stored and sealed within my treasures.

Hittite texts discovered in the royal library of their capital
Hattushas contained tales of conflict between me gods that
had certainly served as a proximate source of Greek myths.
In those texts the names of the Olden Gods are given as had
been known from Sumerian times (such as Anu, Enlil, and
Enki); or in Hittite for gods known from me Sumerian pan-
theon (such as Teshub, "The Wind Blower." for Ishkur/
Adad); or sometimes for deities whose identity remains
obscure. Two epic songs pertain to gods called Kumarbis and
Illuyankas. In the first instance, Teshub demanded that me
Tablets of Fate — "me old tablets with the words of Fate" —
be recovered from Enki's abode in southeastern Africa, and
brought to the Assembly of the Gods. In the other, after
conflict and competition, the gods met in the Assembly to
have their order and ranks established — an order and ranks
mat were pictorially depicted on me rock walls of the sacred
sanctuary now known as Yazilikaya (Fig. 29).

Between Fate and Destiny 81

M*S

i& &AfeM *$

cftrlr

' c

Figure 29

But without doubt one of the most crucial, longest, bitter-
est, and literally fateful was the Assembly of the Gods where
it was determined to approve me use of nuclear weapons to
vaporize the spaceport in the Sinai peninsula. Using primar-
ily the long and detailed record known as me Erra Epos, we
have reconstructed the unfolding events, identified the pro-
tagonists and antagonists, and rendered almost verbatim (in
The Wars of Gods and Men) the proceedings of me Assem-
bly. The unintended result, as has already been mentioned,
was the demise of Sumer and the end of life in its cities.

The occurrence is also one of the clearest if tragic exam-
ples of how Fate and Destiny could be interwoven.

Hardest hit in Sumer was its glorious capital, Ur, seat and
center of its people's beloved god Nannar/Sin (the Moon
god) and his spouse, Ningal. The lamentation texts (Lam-
entation Over the Destruction of Sumer and Ur, Lamentation
Over the Destruction of Ur) describe how, when it was re-
alized that me Evil Wind bearing the cloud of death was
wafting toward Sumer, Nannar/Sin rushed to his father Enlil
with a plea for help, some divine miracle to avert the calam-
ity from Ur. Was it not, he asked his father, unthinkable to
see this pride of Ur, a city throughout renowned, perish? He
appealed to Anu: "Utter, It is enough!' " He appealed to
Enlil: "Pronounce a favorable Fate!" But Enlil saw no way
to change the onrushing end.

In desperation Nannar/Sin insisted that the gods meet in
Assembly. As the senior Anunnaki seated themselves. Nan-
nar/Sin cried his eyes out to Anu, to Enlil made supplica-

82 THE COSMIC CODE

tions. "Let not my city be destroyed, verily I said to them,"
Nannar/Sin later recorded. "Let not the people perish!"

But the response, coming from Enlil, was harsh and de-
cisive:

Ur was granted Kingship;
Eternal reign it was not granted.

OF DEATH AND
RESURRECTION

The lesson of the destruction of Sumer and Ur was that
chance and alterable Fate cannot supersede unalterable Des-
tiny. But what about the other way — can a Fate, no matter
by whom decreed, be superseded by Destiny?

The issue had certainly been pondered in antiquity, for
otherwise what was the reason for prayers and supplications
that had begun then, of the admonitions by the Prophets for
righteousness and repentance? The biblical Book of Job
raises the question whether Fate — to be afflicted to the point
of hopelessness — shall prevail even if Job's righteousness
and piety had destined him to long life.

It was a theme whose origins can be found in the Sumerian
poem that scholars titled Man and His God, whose subject
is the righteous sufferer, a victim of cruel fate and unde-
served misfortune. "Fate grasped me in its hand, carries
away my breath of life," the unnamed sufferer lamented: but
he sees the Gates of Mercy opening up for him "now that
you, my god, have shown me my sins." Confession and
repentance make his god "turn aside the Demon of Fate."
and the supplicant lives a long and happy life.

Just as the tale of Gilgamesh demonstrated that Fate could
not override his ultimate Destiny (to die as a mortal), so did
other tales convey the moral that neither can Fate bring about
death if it was not yet so destined. A paramount example
was none other than Marduk himself, who of all the gods of
antiquity set a record in suffering and setbacks, of disap-
pearances and reappearances, of exiles and returns, of ap-
parent death and unexpected resurrection; so much so, in

83

84 THE COSMIC CODE

fact, that when the full scope of the events concerning Mar-
duk became known after the discovery of ancient inscrip-
tions, scholars seriously debated at the turn of this century
whether his story was a prototype of the story of Christ. (The
notion was abetted by the close affinity between Marduk with
his father Enki on the one hand and with his son Nabu on
the other hand, creating the impression of an early Trinity).
The impact of Marduk's ordeals and its moral for human-
ity was evidenced by a Mystery Play in which his apparent
death and return from the dead were played out by actors.
The Mystery Play was acted out in Babylon as part of the
New Year ceremonies, and various ancient records suggest
that it served a darker purpose as well — to point an accusing
finger at his enemies and judges who were responsible for
his death sentence and entombment. As variant renditions
indicate, the identity of those responsible changed from time
to time to suit the changing political-religious scene.

One of the original accusees was Inanna/Ishtar: and it is
ironic that while she truly had died and resurrected, her mi-
raculous experience was neither reenacted (as was Marduk's)
nor recalled in the calendar (as was the death of her beloved
Dumuzi after whom the month Tammuz was named). This
is doubly ironic because it was as a result of the death of
Dumuzi that Inanna/Ishtar ended up dead.
Not even a Shakespeare could conceive the tragic irony of
the events that followed the entombment and resurrection of
Marduk as a result of Inanna's outcry. For as things turned
out, while he had not truly died or really come back from
the dead, his accuser Inanna did meet actual death and at-
tained true resurrection. And while the death of Dumuzi was
the underlying cause of both occurrences, the cause of In-
anna's death and resurrection was her own fateful decision.
We use the term "fateful" judiciously, for it was her Fate,
not her Destiny, to meet her death; and it was because of
that distinction that she could be resurrected. And the account
of those events illuminates the issues of Life, Death, and
Resurrection not. as the Epic of Gilgamesh, among mortals
or demigods, but among the gods themselves. In her tale of

Of Death and Resurrection 85

Fate versus Destiny, there are clues to the resolution of enig-
mas that have been calling out for solutions.

The suspenseful story of Inanna/Ishtar's death and resur-
rection reveals, from the very beginning, that she met her
death — real death, not just entombment — as a result of her
own decisions. She created her own Fate; but since her death
(at least at that time) was not her Destiny — in the end she
was revived and resurrected.

The tale is recorded in texts written first in the original
Sumerian language, with later renderings in Akkadian.
Scholars refer to the various renditions as the tale of Inanna 's
Descent to the Lower World, although some prefer the term
Netherworld instead of Lower World, implying a hellish do-
main of the dead. But in fact Inanna set her course to the
Lower World, which was the geographic term denoting the
southernmost part of Africa. It was the domain of her sister
Ereshkigal and Nergal, her spouse; and it appears that as a
brother of Dumuzi it was his task to arrange the funeral. And
although Inanna was warned not to go there, she decided to
make the trip anyway.

Attending the funeral rites of her beloved Dumuzi was the
reason Inanna gave for her journey; but it is evident that no
one believed her ... It has been our guess that according to
a custom (that later guided biblical laws), Inanna intended to
demand that Nergal, as an older brother of Dumuzi, sleep
with her so that a son be born as a pseudo-son of Dumuzi
(who had died sonless). And that intention infuriated Eresh-
kigal.

Other texts described the seven objects that Inanna put on
for her use during her travels in her Boat of Heaven — a hel-
met, ear "pendants," a "measuring rod" among them — all
held firmly in place by straps. Sculptures (Fig. 30) depicted
her similarly attired. As she reached the gates of her sister's
abode — seven of them — the gatekeeper stripped her of all
those protective devices, one by one. When she finally en-
tered the throne room, Ereshkigal broke into a rage. There
was a shouting match. According to the Sumerian text, Er-
eshkigal ordered that Inanna be subjected to the "Eyes of

86

THE COSMIC CODE

Figure 30

Death" — some kind of death rays — that turned the body of
Inanna into a corpse; and the corpse was hung on a stake.
According to me later Akkadian version, Ereshkigal ordered
her chamberlain Namtar to "release against Ishtar the sixty
miseries" — afflictions of the eyes, the heart, the head, the
feet, "of all parts of her, against her whole body" — putting
Ishtar to death.

Anticipating trouble, Inanna/Ishtar had instructed her own
chamberlain, Ninshubur, to raise an outcry in the event she
did not return in three days. When she failed to return. Nin-
shubur came before Enlil to beg that Inanna be saved from
death, but Enlil could not help. Ninshubur appealed to Nan-
nar, Inanna's father, but he, too, was helpless. Then Ninshu-
bur appealed to Enki, and he was able to help. He fashioned
two artificial beings who could not be harmed by the Eyes
of Death, and sent them on the rescue mission. To one an-
droid he gave the Food of Life, to the other the Water of

Of Death and Resurrection 87

Figure 3 1

Life; and so provided, they descended to the abode of Er-
eshkigal to reclaim Inanna's lifeless body. Then,

Upon the corpse, hung from the stake,
they directed the Pulser and the Emitter.
Upon the flesh that had been smitten,
sixty times the Food of Life,
sixty times the Water of Life,
they sprinkled upon it;
And Inanna arose.

The use of radiation — a Pulser, and Emitter — to revive the
dead was depicted on a cylinder seal (Fig. 31) in which we
see a patient whose face is covered with a mask being treated
with radiation. The patient who was being revived (whether
man or god is unclear), lying on a slab, was surrounded by
Fishmen — representatives of Enki. It is a clue to be borne in
mind together with the detail in the tale mat while neither
Enlil nor Nannar could help Inanna. Enki could. The an-
droids whom Enki had fashioned to return Inanna from the
dead, however, were not the Fishmen-doctor/priests shown
in the above depiction. Requiring neither food nor water,
sexless and bloodless, they may have looked more like the
figurines of divine android messengers (Fig. 32). It was as

88

THE COSMIC CODE

Figure 32

androids that they were not affected by Ereshkigal's death
rays.

Having resurrected Inanna/Ishtar. they accompanied her on
her safe return to the Upper World. Awaiting her was her
faithful chamberlain Ninshubur. She had many words of grat-
itude for him. Then she went to Eridu, the abode of Enki,
"he who had brought her back to life."

Were Inanna's Descent to the Lower World made into a
Passion Play, as the tale of Marduk was, it would certainly
have kept the audience at the edge of their seats; for whereas
Marduk's "death" was really only an entombment under a
death sentence, and his "resurrection" in reality a rescue
before the point of death, Inanna/Ishtar was truly dead and
her resurrection a true return from the dead. But were some-
one in the audience familiar with the nuances of Sumerian
terminology, he would have known from the midpoint of the
tale that it would turn out all right... For the one whom
Ereshkigal had ordered to put Inanna to death was her cham-
berlain Namtar — not NAM, "Destiny" that was unalterable.

Of Death and Resurrection 89

but NAM.TAR, "Fate" that could be altered.

It was Namtar who put Ishtar to death by "releasing
against her the sixty miseries," and the one who, after she
was revived and resurrected, took her through the seven gates
and returned to her, at each gate, her special attire and adorn-
ments and her attributes of power.

The notion of the realm of Namtar as a Netherworld, an
abode of the dead but at the same time a place from which
one could escape and be back among the living, formed the
basis for an Assyrian text dealing with the near-death expe-
rience of a prince named Kumma.

As in an episode of the TV series The Twilight Zone, the
prince sees himself arriving in the Netherworld. Right off he
sees a man standing before Namtar: "In his left hand he held
the hair of his head, in his right he held a sword." Namtaru,
Namtar's concubine, stood nearby. Monstrous beasts sur-
rounded them: a serpent-dragon with human hands and feet,
a beast with the head of a lion and four human hands. There
was Mukil ("Smiter"), birdlike with human hands and feet,
and Nedu ("Who casts down"), who had the head of a lion,
the hands of a man, and the feet of a bird. Other monsters
had mixed limbs of humans, birds, oxen, lions.

Moving on, the prince comes upon a judgment scene. The
man being judged has a pitch-black body and wears a red
cloak. In one hand he carries a bow, in the other a sword;
with his left foot he treads on a snake. But his judge is not
Namtar, who is only the "vizier of the Netherworld"; the
judge is Nergal, lord of the Lower World. The prince sees
him "seated on a majestic throne, wearing a divine crown."
From his arms lightnings flashed, and "the Netherworld was
filled with terror. "

Trembling, the prince bowed down. When he stood up,
Nergal shrieked at him: "Why did you offend my beloved
wife, Queen of the Netherworld?!" The prince was dumb-
founded and speechless. Was this his end?

But no, no longer in the court of Namtar, mat was not the
bitter end. It was all, in turns out, a case of mistaken identity.
The Queen of the Netherworld herself ordered his release

90 THE COSMIC CODE

and return to the realm of Shamash, the Upper World of
sunlight. But Nergal intervened; the life of the prince might
be spared, but he cannot return from the dead unharmed. He
must suffer from this near-death experience, and become af-
flicted with aches, pains, and insomnia... He has to suffer
from nightmares.

The return of the dead Dumuzi from the Lower World was
quite different.

Revived and freed to go back to the Upper World. Inanna
did not forget her dead beloved. On her orders, the two di-
vine messengers also took back with them the lifeless body
of Dumuzi. They took the body to Bad-Tibira in the Edin;
there the body was embalmed at Inanna's request:

As for Dumuzi, the lover of my youth:
Wash him with pure water,
anoint him with sweet oil,
clothe him in a red garment,
lay him on a slab of lapis-stone.

Inanna ordered that the preserved body be put upon a stone
slab of lapis lazuli to be kept in a special shrine. It should
be preserved, she said, so that one day, on the Final Day,
Dumuzi could return from the dead and "come up to me."
For that, she asserted, would be the day when

The dead one will arise
and smell the sweet incense.

This, one should note, is the first mention of a belief in a
Final Day when the dead shall arise. It was such a belief that
caused the annual wailing for Tammuz (the Semitic render-
ing of Dumuzi) that continued for millennia even unto the
time of the Prophet Ezekiel.

The death and mummification of Dumuzi, though so
briefly told here, provide important insights. When he and
Inanna/Ishtar fell in love — he an Enkiite, she an Enlilite —

Of Death and Resurrection 91

in the midst of conflicts between the two divine clans, the
betrothal received the blessing of Inanna's parents, Nannar/
Sin and his spouse Ningal/Nikkal. One of the texts in the
series of Dumuzi and Inanna love songs has Ningal, "speak-
ing with authority," saying to Dumuzi:

Dumuzi, the desire and love of Inanna:
I will give you life unto distant days;
I will preserve it for you,
I will watch over your House of Life.

But in fact Ningal had no such authority, for all matters
of Destiny and Fate were in the hands of Anu and Enlil.
And, as all later knew, a tragic and untimely death did befall
Dumuzi.

The failure of a divine promise in a matter of life and
deaih is not the only disturbing aspect of the tragic fate of
Dumuzi. It raises the issue of the gods' immortality; we have
explained in our writings that it was only a relative longevity,
a life span resulting from the fact that one year on Nibiru
equaled 3,600 Earth years. But to those who in antiquity
considered the Anunnaki to be gods, the tale of Dumuzi's
death had to come as a shock. Was it because she had indeed
expected Dumuzi to come back to life on the Final Day that
Inanna ordered his embalmment and his placement on a stone
slab rather than burial — or in order to preserve the illusion
of divine immortality for the masses? Yes, she might have
been saying, the god had died, but that is only a temporary,
transitional phase, for in due time he shall be resurrected, he
will arise and enjoy the sweet incense smells.

The Canaanite tales concerning Ba'al, "the Lord," seem
to take the position that one had to distinguish between the
good guys and the bad guys. Seeking to assert his supremacy
and to establish it on the peak of Zaphon (the Secret Place
of the North), Ba'al fought to the death his brother-
adversaries. But in a fierce batde with the "godly Mot"
("Death"), Ba'al is killed.

Anat, the sister-lover of Ba'al, and their sister Shepesh,

92 THE COSMIC CODE

bring the terrible news to Baal's father, El: "Puissant Ba'al
is dead, the Prince, Lord of Earth, is perished!" they tell the
shocked father, in the fields of Dabrland "we came upon
Ba'al, fallen on the ground." Hearing the news, El steps off
his throne and sits down on a stool, as mourner's custom is
(among the Jews) to this day. "He pours dust of mourning
on his head, puts on sackcloth." With a stone knife he gashes
himself; "he lifts up his voice and cries: Ba'al is dead!"

The grieving Anat returns to the field where Ba'al had
fallen and, like El, puts on sackcloth, gashes herself, then
"weeps her fill of weeping." Then she calls her sister She-
pesh to come and help her carry the lifeless body to the
Fastness of Zaphon, there to bury the dead god:

Hearkening, Shepesh, the gods' maiden,

picks up Puissant Baal,

sets him on Anat's shoulder.

Up to Zaphon's fastness she brings him,

bewails him and buries him;

She lays him in a hollow,

to be with the earth-ghosts.

Completing the requisites of mourning, Anat returns to
El's abode. Bitterly she tells those gathered: Now you can
go and rejoice, for Ba'al is dead, and his throne is free! The
goddess Elath and her kinsmen, ignoring Anat's irony, mer-
rily go about discussing succession. As one of the other of
El's sons is recommended, El says no, he is a weakling.
Another candidate is permitted to go to Zaphon, to try out
Ba'al's throne; "but his feet reach not down to the foot-
stool," and he, too, is eliminated. No one, it appears, can
replace Ba'al.

This gives Anat hope: resurrection. Enlisting again the
help of Shepesh, she penetrates Mot's abode. Using subter-
fuge, she "draws near to him, like a ewe for her lamb...
She seizes the godly Mot and with a sword she cleaves him."
Then she burns the dead Mot's body, grinds the remains,
spreads the ashes over the fields.

Of Death and Resurrection 93

And the killing of Mot. who had killed Ba'al, triggers a
miracle: the dead Ba'al comes back to life!

Indeed did Puissant Baal die;

Indeed did the Lord of Earth perish.

But lo and behold:

Alive is Puissant Baal!

Behold, existent is the princely Lord of Earth!

Getting the news, El wonders whether it is all a dream,
"a vision." But it is true! Casting off the sackcloth and ways
of mourning, El rejoices:

Now will I sit up and find rest,
and my heart shall be at ease;
For alive is Puissant Baal,
Existent is the prince, Lord of Earth.

In spite of El's evident uncertainty whether the resurrec-
tion is an illusory vision, a mere dream, the Canaanite story-
teller chose to assure the people that in the end even El
accepts the miracle. The assurance is echoed in the tale of
Keret, who is only a demigod; yet his sons, seeing him in
the throes of death, cannot believe thai "a son of El shall
die."

It is perhaps in light of the unacceptability of a god's death
that the notion of resurrection has been brought into play.
And whether or not Inanna herself believed mat her beloved
would return from the dead, the elaborate preservation of
Dumuzi's body and her accompanying words also preserved,
among me human masses, the illusion of the immortality of
the gods.

The procedure that she personally outlined for the pres-
ervation, so that on the Final Day Dumuzi could arise and
rejoin her, is undoubtedly the procedure known as mummi-
fication. This might come as a shock to Egyptologists, who
have held that mummilication began in Egypt at the time of
the Third Dynasty, circa 2800 B.C. There the procedure en-

94 THE COSMIC CODE

"Pt«fe"

I

Figure 33

tailed washing the body of the departed Pharaoh, rubbing it
with oils, and wrapping it in a woven cloth — preserving the
body so that the Pharaoh could undertake a Journey to the
Afterlife.

Yet here we have a Sumerian text recording mummifica-
tion centuries earlier!

The procedure's step-by-step details in this text are iden-
tical to what was later practiced in Egypt, down to the color
of the enshrouding cloth.

Inanna ordered that the preserved body be put to rest upon
a stone slab of lapis lazuli, to be kept in a special shrine.
She named the shrine E.MASH — "House/Temple of the Ser-
pent." It was perhaps more than a symbolic gesture of plac-
ing the dead son of Enki in his father's hands. For Enki was
not only me Nachash — Serpent, as well as Knower of Se-
crets — of the Bible. In Egypt, too, his symbol was the serpent
and the hieroglyph of his name PTAH represented the double
helix of DNA (Fig. 33), for that was the key to all matters
of life and death.

Though venerated in Sumer and Akkad as Inanna's be-
trothed and mourned in Mesopotamia and beyond as Ishtar's
departed Tammuz, Dumuzi was an African god. It was thus
perhaps inevitable that his death and embalmment would be
compared by scholars to the tragic tale of the great Egyptian
god Osiris.

The story of Osiris is akin to the biblical tale of Cain and

Of Death and Resurrection

95

Figure 34

Abel in which a rivalry ended in a brother killing a brother.
It begins with two divine couples, two half brothers (Osiris
and Seth) marrying two sisters (his and Nepthys). To avoid
recriminations, the Kingdom of the Nile was divided between
the two brothers: Lower Egypt (the northern part) was allot-
ted to Osiris and the southern part (Upper Egypt) to Seth.
But the complex divine rules of succession, giving preference
to the Legitimate Heir over the Firstborn Son, inflamed the
rivalry to the point where Seth, using a ruse, trapped Osiris
inside a chest which was then cast into the Mediterranean
Sea, and Osiris was drowned.

Isis, the spouse of Osiris, found the chest when it was
washed ashore in what is now Lebanon. She took the body
of her husband Osiris back to Egypt, seeking the help of the
god Thoth to resurrect Osiris. But Seth found out what was
going on, seized the corpse, cut it up into fourteen pieces,
and dispersed the pieces all over Egypt.

Unyielding, Isis searched for the pieces and found them
all, except (so the tale says) the phallus of Osiris. She put
the pieces back together, binding them with a woven purple
cloth to reconstitute Osiris's body — "thus starting mummifi-
cation in Egypt. All the depictions of Osiris from pharaonic
times show him tightly wrapped in the shroud (Fig. 34).

Like Inanna before her, so did Isis enshroud and mummify
her deceased spouse, thereby giving rise in Egypt (as In-
anna's deed had done in Sumer and Akkad) to the notion of

96

THE COSMIC CODE

Figure 35

the resurrected god. While in Inanna's case the deed by the
goddess might have been intended to satisfy a personal denial
of the loss as well as to affirm the gods' immortality, in
Egypt the act became a pillar of the pharaonic belief that the
human king could also undergo the transfiguration and, by
emulating Osiris, attain immortality in an afterlife with the
gods. In the words of E. A. Wallis Budge in the preface to
his masterwork Osiris & The Egyptian Resurrection, "The
central figure of the ancient Egyptian Religion was Osiris,
and the chief fundamentals of his cult were the belief in his
divinity, death, resurrection and absolute control of the des-
tinies of the bodies and souls of men." The principal shrines
to Osiris in Abydos and Denderah depicted the steps in the
god's resurrection (Fig. 35). Wallis Budge and other scholars
believed that these depictions were drawn from a Passion or
Mystery Play that had been acted out annually at those
places — a religious ritual that, in Mesopotamia, was ac-
corded to Marduk.
The Pyramid Texts and other funerary quotes from the

Of Death and Resurrection

97

i**te

Figure 36

Egyptian Book of the Dead related how the dead Pharaoh,
embalmed and mummified, was prepared to exit his tomb
(deemed only a temporary restplace) through a false door on
the east and begin a Journey to the Afterlife. It was presumed
to be a journey simulating the journey of the resurrected
Osiris to his heavely throne in the Eternal Abode; and though
it was a journey that made the Pharaoh soar heavenward as
a divine falcon, it began by passing through a series of un-
derground chambers and subterranean corridors filled with
miraculous beings and sights. In The Stairway to Heaven we
have analyzed the geography and topography of the ancient
texts and concluded that it was a simulation of a journey to
an underground launch silo in the Sinai peninsula — not un-
like the actual depiction of an actual site in the peninsula in
the tomb of Hui, a pharaonic governor of the Sinai peninsula
(Fig. 36).

98

THE COSMIC CODE

Figure 37

The resurrection of Osiris was coupled with another mi-
raculous feat, that of bringing about the birth of his son,
Horus, well after Osiris himself was dead and dismembered.
In both events, which the Egyptians rightly considered to be
magical, a god called Thoth (always shown in Egyptian art
as Ibis-headed, Fig. 37) played the decisive role. It was he
who aided Isis in putting the dismembered Osiris together,
and then instructed her how to extract the "essence" of Osi-
ris from his dismembered and dead body, and then impreg-
nate herself artificially. Doing that, she managed to become
pregnant and give birth to a son, Horus.

Even those who take the tale to be a recollection of some
actual events and not just a "myth" assume that what Isis
did was to extract from the dead Osiris his semen, and thus
his "essence." But this was impossible, since the one part
that Isis could not find and recombine was his male organ.
The magical feat of Thoth had to go beyond artificial insem-

Of Death and Resurrection 99

ination, now quite common. What he had to do was to obtain
for her the genetic "essence" of Osiris. The texts as well as
depictions coming to us from ancient Egypt confirm mat
Thoth indeed possessed the "secret knowledge" needed for
such feats.

The biomedical — "magical" in human eyes — capabilities
of Thoth were called upon once more for the sake of Horus.
In order to protect the boy from the ruthless Seth, Isis kept
the birth of Horus a secret, hiding him in a swampy area.
Unaware of the existence of a son of Osiris, Seth — just as
Enki had tried to obtain a son by his half sister Ninmah —
tried to force Isis, his half-sister, to have intercourse with
him so that he might have a son by a half sister, and thus an
uncontested heir. Luring Isis to his abode, he held her captive
for a while; but Isis managed to escape and returned to me
swamps where Horus was hidden. To her grief she found
Horus dead from a sting of a poisonous scorpion. She lost
no time in calling for help from Thoth:

Then Isis sent forth a cry to heaven

and addressed her appeal to the

Boat of Millions of Years...

And Thoth came down;

He was provided with magical powers,

and possessed the great power which made

the word turn into deed. ..

And he said to Isis:

I have come this day in the Boat of the Celestial

Disc from the place where it was yesterday.

When the night cometh,

this Light [beam] shall drive away [the poison]

for the healing of Horus ...

I have come from the skies to save the child

for his mother.

100 THE COSMIC CODE

Thus revived and resurrected from death (and perhaps for-
ever immunized) by the magical powers of Thoth, Horus
grew up to become Netch-Atef, the "Avenger" of his father.

The biomedical powers of Thoth in matters of life and
death were also recorded in a series of ancient Egyptian texts
known as Tales of the Magicians. In one of them (Cairo
Papyrus 30646) a long tale deals with a couple of royal de-
scent who unlawfully took possession of the Book of the
Secrets of Thoth. In punishment Thoth buried them in a sub-
terranean chamber in a state of suspended animation — mum-
mified as the dead but able to see, hear, and speak. In another
tale, written on the Westcar Papyrus, a son of the Pharaoh
Khufu (Cheops) told his father of an old man who "was
acquainted with the mysteries of Thoth." Among them was
the ability to restore life to the dead. Wishing to see this with
his own eyes, the king ordered that a prisoner's head be cut
off, then challenged the sage to reconnect the severed head
and return the man to life. The sage refused to perform this
"magic of Thoth" on a human being; so the head of a goose
was severed. The sage "spoke certain words of power" from
the Book of Thoth; and lo and behold, the severed head
joined itself back to the body of the goose, the goose stood
up, waddled, then began to honk — alive as before.

That Thoth had indeed possessed the ability to resurrect a
dead person who had been beheaded, reattach the head, and
return the victim to life, was known in ancient Egypt because
of an incident that had occurred when Horus finally took up
arms against his uncle Seth. After battles that raged on land,
water, and in the air, Horus succeeded in capturing Seth and
his lieutenants. Bringing them before Ra for judgment, Ra
put the captives' fate in the hands of Horus and Isis.
Thereupon Horus started to slay the captives by cutting off
their heads; but when it came to Seth, Isis could not see this
done to her brother and stopped Horus from executing Seth.
Enraged, Horus turned on his own mother and beheaded her!
She survived only because Thoth rushed to the scene, re-
attached her head, and resurrected her.

To appreciate Thoth's ability to achieve all that, let us

Of Death and Resurrection

101

Figures 38a, 38b, and 38c

recall that we have identified this son of Ptah as Ningishzidda
(son of Enki in Sumerian lore), whose Sumerian name meant
"Lord of the Tree/ Artifact of Life." He was the Keeper of
[the] Divine Secrets of the exact sciences, not me least of
which were the secrets of genetics and biomedicine that had
served well his father Enki at the time of the Creation of
Man. Sumerian texts, in fact, attest that at one time Marduk
complained to his father Enki that he was not taught all the
knowledge that Enki possessed.

"My son," responded Enki, "what is it that you do not
know? What more could I give to you?" The withheld
knowledge, Marduk pointed out, was the secret of resurrect-
ing the dead; that secret knowledge was imparted by Enki to
Marduk's brother, Ningishzidda/Thoth, but not to Marduk/
Ra.

That secret knowledge, those powers granted to Thoth/
Ningishzidda, found expression in Mesopotamian art and
worship by depicting him by or with the symbol of me En-
twined Serpents (Fig. 38a) — a symbol that we have identified
as a representation of the double helix DNA (Fig. 38b) — a
symbol that has survived to our time as the emblem of med-
icine and healing (Fig. 38c).

There was undoubtedly a connection between all that and

102

THE COSMIC CODE

Figure 39

the fashioning by Moses of a copper serpent in order to stop
a pestilence that felled countless Israelites during the Exodus.
Raised in the Pharaoh's court and trained by Egypt's magi-
cians, Moses, on the Lord's instructions, "made a copper
serpent, and placed it atop a Miracle Pole," and when those
who were afflicted by the plague looked up to the copper
serpent, they remained alive (Numbers 21:8-10).

It is perhaps more than a coincidence that one of the lead-
ing international authorities on ancient copper mining and
metallurgy, Professor Benno Rothenberg (Midianite Timna
and other publications), discovered in the Sinai peninsula a
shrine dating back to the time of the Midianite period — the
time when Moses, having escaped to the Sinai wilderness for
his life — dwelt with the Midianites and even married the
daughter of the Midianite high priest. Located in the area
where some of me earliest copper mining had taken place,
Professor Rothenberg found in the shrine's remains a small
copper serpent; it was the sole votive object there. (The
shrine has been reconstructed as an exhibit in the Nechushtan
Pavilion of the Eretz Israel Museum in Tel Aviv, Fig. 39,
where the copper serpent can also be seen.)

The biblical record and the finds in the Sinai peninsula
have a direct bearing on the depiction of Enki as a Nachash.
The term has not just the two meanings mat we have already
mentioned ("Serpent," "Knower of Secrets") but also a
third one — "He of Copper," for the Hebrew word for cop-

Of Death and Resurrection 103

per, Nechoshet, stems from the same root. One of Enki's
epithets in Sumerian, BUZUR, also has the double meaning
"He who knows/solves secrets" and "He of the copper
mines."

These various interconnections may offer an explanation
of the otherwise puzzling choice by Inanna of a resting place
for Dumuzi: Bad-Tibira. Nowhere in the relevant texts is
there any indication of a connection between Dumuzi (and,
for mat matter, Inanna) and that City of the Gods. The only
possible connection is the fact that Bad-Tibira was estab-
lished as the metallurgical center of the Anunnaki. Did In-
anna, then, place the embalmed Dumuzi near where not only
gold but also copper was refined?

Another possibly relevant tidbit concerns the construction
of the Tabernacle and Tent of Appointment in the desert of
the Exodus, in accordance with very detailed and explicit
instructions by Yahweh to Moses: where gold or silver were
to be used and how. what kinds of woods or timbers and in
what sizes, what manner of cloth or skins, how sewn, how
decorated. Great care is also taken in these instructions re-
garding the rites to be performed by the priests (only Aaron
and his sons at that time): their clothing, the sacred objects
they would wear, the very explicit combination of ingredients
that would make the unique incense that would result in the
proper cloud to shield them from the deathly radiation by
the Ark of the Covenant. And men one more requirement:
the fashioning of a washbasin in which they had to wash
their hands and feet, "so that they the not when they enter
the Ark of the Covenant." And the washbasin, Exodus 30:
17 specified, must be made of copper.

All these dispersed but seemingly connected facts and tid-
bits suggest that copper somehow played a role in human
biogenetics — a role which modern Science is only beginning
to uncover (a recent example is a study, published in the
journal Science of 8 March 1996, about the disruption of
copper metabolism in the brain associated with Alzheimer's
disease).

Such a role, if not part of the first genetic endeavor by

104 THE COSMIC CODE

Enki and Ninmah to produce The Adam, seems to have cer-
tainly entered the human genome when Enki, as the Nachash,
engaged in the second manipulation when Mankind was en-
dowed with the ability to procreate.

Copper, in other words, was apparently a component
of our Destiny, and a studious and expert analysis of the
Sumerian creation texts might well lead to medical break-
throughs that could affect our own daily lives.

As for the gods, Inanna, for one, believed that copper
might assist her beloved's resurrection.

THE COSMIC CONNECTION:
DNA

Even before television, courtroom dramas have titillated
many and trials made history. We have come a long way
from the biblical rule, "by two witnesses shall the verdict
be." From eyewitnesses court evidence has moved to doc-
umentary evidence, to forensic evidence, and — what seems
at the moment as the epitome — to DNA evidence.

Having discovered that all life is determined by the tiny
bits of nucleic acids that spell out heredity and individuality
on chains called chromosomes, modem science has attained
the capability of reading those entwined DNA letters to dis-
tinguish their unique, individually spelled "words." Using
DNA readings to prove guilt or innocence has become the
highlight of courtroom dramas.

An unmatched feat of twentieth-century sophistication?
No, a feat of lOOth-century sophistication in the past — a
court drama from 10,000 B.C.

The ancient celebrated case took place in Egypt, at a time
when gods and not yet men reigned over the land: and it
concerned not men but the gods themselves. It concerned the
adversaries Seth and Horns and had its roots in the rivalry
between the half brothers Seth and Osiris. Seth, it will be
recalled, resorted to foul play to get rid of Osiris and take
over his domains. The first time he tricked Osiris into a chest
that Seth quickly sealed and sank in the Mediterranean Sea;
but Isis found the chest and, with the help of Thoth, revived
Osiris. The next time the frustrated Seth seized and cut up
Osiris into fourteen pieces. Isis located the dispersed pieces
and put them together, and mummified Osiris to start the

105

106 THE COSMIC CODE

Afterlife legend. She missed, however, the god's phallus,
which she could not find, for Seth had disposed of it so that
Osiris would have no heir.

Determined to have one so that he would avenge his fa-
ther, Isis appealed to Thoth, the Keeper of Divine Secrets,
to help her. Extracting the "essence" of Osiris from the dead
god's available parts, Thoth helped Isis impregnate herself
and give birth to a son, Horus.

The "essence" (not "seed"!), we now know, was what
we nowadays call DNA — the genetic nucleic acids that form
chains on the chromosomes, chains that are arranged in base
pairs in a double helix (see Fig. 38b). At conception, when
the male sperm enters the female egg, the entwined double
helixes separate, and one strand from the male combines with
one strand from the female to form a new double-helixed
DNA for their offspring. It is thus essential not only to bring
together the two double-helixed DNAs, but also to attain a
separation — an unwinding — of the double strands, and then
a recombining of only one strand from each source into the
new entwined double-helixed DNA.

Pictorial depictions from ancient Egypt indicate that
Thoth — the son of Ptah/Enki — was well aware of these
biological-genetic processes and employed them in his
genetic feats. In Abydos, a wall painting (Fig. 40), in which
the Pharaoh Seti I acted out the role of Osiris, showed Thoth
giving Life (the Ankh symbol) back to the dead god while
obtaining from him the two distinct strands of DNA. In a
depiction from the Book of the Dead dealing with the sub-
sequent birth of Horus, we see (Fig. 41) how the two Birth
Goddesses assisting Thoth hold one strand each of DNA, the
DNA's double helix having been separated so mat only one
strand recombines with that of Isis (shown holding the new-
bom Horus).

Isis raised the boy in secret. When he came of age, his
mother decided that it was time to claim for him his father's
inheritance. So one day, to Seth's utter surprise, Horus ap-
peared before the Council of the Great Gods and announced
that he was the son and heir of Osiris. It was an incredible

The Cosmic Connection: DNA

107

Figure 40

claim, yet one that could not be dismissed out of hand. Was
the young god really the son of the dead Osiris?

As recorded in a text known as the Chester Beatty Papyrus
No. 1, the appearance of Horus astounded the assembled
gods, and of course Seth more than any other. As the council
began to deliberate the sudden claim, Seth had a conciliatory
suggestion: Let the deliberations be recessed, so as to give
him a chance to get acquainted with Horus and see if the
matter could be settled amicably. He invited Horus to
"come, let us pass a happy day in my house." and Horus
agreed. But Seth, who had once tricked Osiris to his death,
had new treachery in mind:

When it was eventide,

the bed was spread for them,

and the twain lay thereon.

108

THE COSMIC CODE

Figure 41

And in the night

Seth caused his member to become stiff,

and he made it go between the loins of Horus.

When the deliberations were resumed, Selh made an
astounding announcement. Whether or not Horus is the son
of Osiris, he said, matters no more. For now his, Seth's, seed
is in Horus, and that makes Horus a successor of Seth rather
than a front-runner for the succession!

Then Horus made an even more surprising announcement.
On the contrary, he said, it is not I who have been disqual-
ified — it is Seth! And he went on to tell that he was not
really asleep when Seth poured his semen. It did not enter
my body, he said, because "I caught the seed between my
hands." In the morning he took the semen to show it to his
mother Isis, and the report gave her an idea. She made Horus
erect his member and ejaculate his semen into a cup; then
she spread the semen of Horus on lettuce in Seth's garden — a
favorite breakfast food of Seth. Unknowingly, he ended up
ingesting the semen of Horus. So, Horus said, it is my semen
that is in Seth, and now he can succeed me but not precede
me on the divine throne...

The Cosmic Connection: DNA 109

Totally baffled, the Council of the Gods turned to Thoth
to resolve the issue. Using his powers of genetic knowledge,
he checked the semen that Isis had kept in a pot, and found
it to indeed be that of Seth. He examined Horns and found
no traces of Seth's DNA in him. Then he examined Seth,
and found that he had indeed ingested me DNA of Horus.

Acting as a forensic expert in a modern court, but evi-
dently armed with technical abilities which we are yet to
attain, he submitted the DNA analysis results to the Council
of the Gods. They voted unanimously to grant the dominion
over Egypt to Horus.

(Seth's refusal to yield the dominion led to what we have
termed the First Pyramid War, in which Horus enlisted, for
the first time, humans in a war between the gods. We have
detailed those events in The Wars of Gods and Men).

Recent discoveries in genetics throw light on a persistent
and seemingly odd custom of the gods, and at the same time
highlight their biogenetic sophistication.

The importance of the wife-sister in the succession rules
of the gods of Mesopotamia and Egypt, evident from all that
we have reported thus far, was echoed also in the Greek
myths regarding their gods. The Greeks named the first di-
vine couple, emerging out of Chaos, Gaea ("Earth") and
Uranus ("Sky" or "Heaven"). Of them twelve Titans were
brought forth, six males and six females. Their intermarriages
and varied offspring laid the groundwork for later struggles
for supremacy. Of the earliest struggles the one who emerged
on top was Cronus, the youngest male Titan, whose spouse
was his sister Rhea; their children were the three sons Hades,
Poseidon and Zeus, and me three daughters Hestia, Demeter
and Hera. Though Zeus fought his way up to the supremacy,
he had to share dominion with his brothers. The three divided
the domains among them — some versions say by drawing
lots — very much as Anu, Enlil, and Enki had: Zeus was the
heavenly god (yet residing on Earth, on Mount Olympus);
Hades was accorded me Lower World; and Poseidon the
seas.

110 THE COSMIC CODE

The three brothers and three sisters, offspring of Cronus
and Rhea, constituted the first half of the Olympian Circle
of twelve. The other six were offspring of Zeus, bom when
Zeus consorted with a variety of goddesses. Of one of them,
Leto, he had his Firstborn Son, the great Greek and Roman
god Apollo. When it was time, however, to obtain a male
heir in accordance with me succession rules of the gods, Zeus
turned to his own sisters. Hestia, the oldest, was by all ac-
counts a recluse, too old or too sick to be the object of mat-
rimony and childbearing. Zeus thus sought a son by his
middle sister, Demeter; but instead of a son she bore him a
daughter, Persephone. This paved the way for Zeus to marry
Hera, the youngest sister; and she did bear to Zeus a son,
Ares, and two daughters (Ilithyia and Hebe). When the
Greeks and Romans, who lost the knowledge of the planets
beyond Saturn, named the known planets, they assigned
one — Mars — to Ares; though not me Firstborn Son, he was
Zeus's Foremost Son. Apollo, as great a god as he was, had
no planet named after him by the Greeks and Romans.

All this reinforces the importance of the wife-sister in the
annals of the gods. In matters of succession, the issue arose
again and again: Who will me successor to the throne be —
the Firstborn Son or the Foremost Son, if the latter was born
by a half sister and the former not? That issue appears to
have dominated and dictated the course of events on Earth
from the moment Enlil joined Enki on this planet, and the
rivalry was continued by their sons (Ninurta and Marduk,
respectively). In Egyptian tales of the gods, a conflict for
similar reasons reared its head between Ra's descendants,
Seth and Osiris.

The rivalry, which from time to time flared into actual
warfare (Horus in the end fought Seth in single combat in
the skies of the Sinai peninsula), by all accounts did not
begin on Earth. There were similar conflicts of succession
on Nibiru, and Anu did not come by his rulership without
fights and battles.

Like the custom that a widow left without a son could
demand me husband's brother to "know" her as a surrogate

The Cosmic Connection: DNA 111

husband and give her a son, so did the Anunnnaki's rules of
succession, giving priority to a son by a half sister, find their
way into the customs of Abraham and his descendants. In
his case, his first son was Ishmael, born by the handmaiden
Hagar. But when, at an incredible old age and after divine
intervention, Sarah bore Isaac — it was Isaac who was the
Legitimate Heir. Why? Because Sarah was Abraham's half
sister. "She is my sister, the daughter of my father but not
of my mother." Abraham explained (Genesis 20:12).

The marrying of a half sister as a wife was prevalent
among the Pharaohs of Egypt, as a means both to legitimize
the king's reign and me succession. The custom was even
found among the Inca kings of Peru, so much so that the
occurrence of calamities during a certain king's reign was
attributed to his marrying a woman who was not his halt
sister. The Inca custom had its roots in the Legends of Be-
ginnings of the Andean peoples, whereby the god Viracocha
created four brothers and four sisters who intermarried and
were guided to various lands. One such brother-sister couple,
which was given a golden wand with which to find the Navel
of the Earth in South America, began kingship in Cuzco (the
erstwhile Inca capital). That was why Inca kings — providing
they had been born of a succession of brother-sister royal
couples — could claim direct lineage to the Creator God Vi-
racocha.

(Viracocha, according to Andean legends, was a great God
of Heaven who had come to Earth in antiquity and chose the
Andean mountains as his arena. In The Lost Realms we have
identified him as the Mesopotamian god Adad = the Hittite
god Teshub, and pointed to many other similarities, besides
the brother-sister customs, between the Andean cultures and
those of the ancient Near East).

The persistence of the brother-sister intermarriage and the
seemingly totally out of proportion significance attached to
it, among gods and mortals alike, is puzzling. The custom
on the face of it appears to be more than a localized "let's
keep the throne in the family" attitude, and at worst the
courting of genetic degradation. Why, then, the lengths to

112 THE COSMIC CODE

which the Anunnaki (example: Enki's repeated efforts to
have a son by Ninmah) went to attain a son by such a union?
What was so special about the genes of a half sister — the
daughter, let us keep in mind, of the male's mother but def-
initely not of the father?

As we search for the answer, it will help to note other
biblical practices affecting the mother/father issues. It is cus-
tomary to refer to the period of Abraham, Isaac, Jacob, and
Joseph as the Patriarchal Age, and when asked most people
would say that the history related in the Old Testament has
been presented from a male-oriented viewpoint. Yet the fact
is that it was the mothers, not the fathers, who controlled the
act that, in the ancients' view, gave the subject of the tale
its status of "being" — the naming of the child. Indeed, not
only a person but a place, a city, a land, were not deemed
to have come into being until they were given a name.

This notion, in fact, goes back to the beginning of time,
for the very opening lines of the Epic of Creation, wishing
to impress on the listener that the story begins before the
Solar System had been fully fashioned, declare that the story
of Tiamat and the other planets begins

Enuma elish la nabu shamamu

When in the heights heaven had not been named

Shapiltu ammatum shuma la zakrat

And below, firm ground (Earth) had not been called

And in the important matter of naming a son, it was either
the gods themselves or the mother whose privilege it was.
We thus find that when the Elohim created Homo sapiens, it
was they who named the new being "Adam" (Genesis 5:2).
But when Man was given the ability to procreate on his own,
it was Eve — not Adam — who had the right and privilege of
naming their first male child Cain (Genesis 4:1) as well as
Seth who replaced the slain Abel (Genesis 4:25).

At the start of the "Patriarchal (!) Age" we find that the
privilege of naming the two sons of Abraham was taken over
by divine beings. His firstborn by Hagar, his wife's hand-

The Cosmic Connection: DNA 113

maiden, was called Ishma'el by an Angel of Yahweh (Gen-
esis 16:11); and the Legitimate Heir Isaac (Itzhak, "Who
causes laughter") was so named by one of the three divine
beings who visited Abraham before the destruction of Sodom
and Gomorrah (because when Sarah had heard God saying
that she would have a son, she laughed; Genesis 17:19;
18:12). No specific information is provided in the Bible re-
garding the two sons of Isaac by Rebecca, Esau and Jacob
(it is simply stated that this is how they were called). But
then it is clearly stated that it was Leah who named Jacob's
sons by her and by her handmaiden, as did Rachel (Genesis
chapters 29 and 30). Centuries later, after the Israelites had
settled in Canaan, it was Samson's mother who so named
him (Judges 13:24); so did the mother of the Man of God,
Samuel (1 Samuel 1:20).

The Sumerian texts do not provide this kind of informa-
tion. We do not know, for example, who named Gilgamesh —
his mother the goddess or his father the High Priest. Bui the
tale of Gilgamesh provides an important clue to the solution
of the puzzle at hand: the importance of the mother in de-
termining the son's hierarchical standing.

His search for attaining the longevity of the gods, it will
be recalled, led him first to the Landing Place in the Cedar
Mountains; but he and his companion Enkidu were prevented
from entering by its robotic guardian and the Bull of Heaven.
Gilgamesh then journeyed to the spaceport in the Sinai pen-
insula. The access to it was guarded by awesome Rocketmen
who trained on him "the dreaded spotlight that sweeps the
mountains" whose "glance was death" (Fig. 42); but Gil-
gamesh was not affected; whereupon one Rocketman shouted
to his comrade:

He who comes,

of the flesh of the gods

is his body!

114

THE COSMIC CODE

Figure 42

Permitted to approach. Gilgamesh confirmed the guard's
conclusion: Indeed he was immune to the death rays because
his body was of the "flesh of the gods." He was, he ex-
plained, not just a demigod — he was "two-thirds divine."
because it was not his father but his mother who was a god-
dess, one of the female Anunnaki.

Here, we believe, is the key to the puzzle of the suc-
cession rules and other emphasis on the mother. It is
through her that an extra "qualifying dose" was given
to the hero or the heir (be it Anunnaki or patriarchal).

This seemed to make no sense even after the discovery,
in 1953, of the double-helix structure of DNA and the un-
derstanding how the two strands unwind and separate so that
only one strand from the female egg and one strand from the
male sperm recombine, making the offspring a fifty-fifty im-
age of its parents. Indeed, this understanding, while explain-
ing the demigod claims, defied the inexplicable claim of
Gilgamesh to be two-thirds divine.

It was not until the 1980s that the ancient claims began to
make sense. This came with the discovery that in addition to
the DNA stored in the cells of both males and females in the
double-helix structures on the chromosome stems, forming
the cell's nucelus, there was another kind of DNA that floats

The Cosmic Connection: DNA 115

in the cell outside the nucelus. Given the designation Mito-
chondrial DNA (mtDNA), it was found to be transmitted
only from the mother as is, i.e. without splitting and recom-
bining with any DNA from the male.

In other words, if the mother of Gilgamesh was a goddess,
then he had indeed inherited both her half of the regular
DNA plus her mtDNA, making him, as he had claimed, two-
thirds divine.

It was this discovery of the existence and transmittal as is
of mtDNA that has enabled scientists, from 1986 on, to trace
the mtDNA in modern humans to an "Eve" who had lived
in Africa some 250,000 years ago.

At first scientists believed that the sole function of mtDNA
was to act as the cell's power plant, providing the energy
required for the cell's myriad chemical and biological reac-
tions. But then it was ascertained that the mtDNA was made
of "mitochondrions" containing 37 genes arranged in a
closed circle, like a bracelet; and that such a genetic "brace-
let" contains over 16,000 base pairs of the genetic alphabet
(by comparison, each of the chromosomes making up the
cell's core that are inherited half from each parent contains
upward of 100,000 genes and an aggregate of more than
three billion base pairs).

It took another decade to realize that impairments in the
makeup or functions of mtDNA can cause debilitating dis-
orders in the human body, especially of the nervous system,
of heart and skeletal muscles, and of the kidneys. In the
1990s researchers found that defects ("mutations") in
mtDNA also disrupt the production of 13 important body
proteins, resulting in various severe ailments. A list published
in 1997 in Scientific American starts with Alzheimer's dis-
ease and goes on to include a variety of vision, hearing,
blood, muscle, bone marrow, heart, kidney, and brain mal-
functions.

These genetic ailments join a much longer list of bodily
malfunctions and dysfunctions that defects in the nuclear
DNA can cause. As scientists unravel and understand the
"genome" — the complete genetic code — of humans (a feat

116

THE COSMIC CODE

Figures 43a and 43b

recently achieved for a single lowly bacterium), the function
that each gene performs (and as the other side of the coin,
the ailments if it is absent or malfunctions) is steadily be-
coming known. By not producing a certain protein or enzyme
or other key bodily compound, the gene regulating that has
been found to cause breast cancer, or hinder bone formation,
deafness, loss of eyesight, heart disorders, the excessive gain
of weight or the opposite thereof, and so on and on.

What is interesting in this regard is that we come across
a list of similar genetic defects as we read the Sumerian texts
about the creation of the Primitive Worker by Enki with the
assistance of Ninmah. The attempt to recombine the strands
of hominid DNA with strands of Anunnaki DNA to create
the new hybrid being was a process of trial and error, and
the beings initially brought about sometimes lacked organs
or limbs — or had too many of them. The Babylonian priest
Berossus, who in the third century B.C. compiled for the
Greeks the history and knowledge of the earlier Sumerians,
described the failed results of Man's creators by reporting
that some of the trial-and-error beings had two heads on one
body. Such "monsters" have indeed been depicted by the
Sumerians (Fig. 43a), as well as another anomaly — a being

The Cosmic Connection: DNA 1 17

with one head but two faces called Usmu (Fig. 43b). Spe-
cifically mentioned in the texts was a being who could not
hold its urine, and a variety of malfunctions including eye
and eyesight diseases, trembling hands, an improper liver, a
failing heart, and "sicknesses of old age." The text called
Enki and Ninmah: The Creation of Mankind, besides listing
more dysfunctions (rigid hands, paralyzed feet, dripping se-
men) also depicted Enki as a caring god who. rather than
destroying such deformed beings, found some useful life for
them. Thus, when one outcome was a man with faulty eye-
sight, Enki taught him an art that did not require seeing —
the art of singing and the playing of a lyre.

To all those, the text states, Enki decreed this or that Fate.
He then challenged Ninmah to try the genetic engineering
on her own. The results were terrible: the beings she brought
about had the mouth in the wrong place, a sick head, sore
eyes, aching neck, shaky ribs, malfunctioning lungs, a heart
ailment, inability to move the bowels, hands that were too
short to reach the mouth, and so on and on. But as the trial
and error continued, Ninmah was able to correct the various
defects. Indeed, she reached a point that she became so
knowledgeable of the Anunnaki/hominid genomes that she
boasted that she could make the new being as perfect or
imperfect as she wished:

How good or bad is man's body?

As my heart prompts me,

1 can make its fate good or bad.

We, too, have now reached the stage where we can insert
or replace a certain gene whose role we have uncovered, and
try to prevent or cure a specific disease or shortcoming. In-
deed, a new industry, the biotechnology industry, has sprung
up, with a seemingly limitless potential in medicine (and the
stock market). We have even learned to perform what is
called transgenic engineering — the transfer of genes between
different species, a feat that is achievable because all the
genetic material on this planet, from the lowest bacterium to

118 THE COSMIC CODE

the most complex being (Man), of all living organisms that
roam or fly or swim or grow, is made up of the same genetic
ABC — the same nucleic acids that formed the "seed"
brought into our Solar System by Nibiru.

Our genes are, in fact, our cosmic connection.

Modern advances in genetics move along two parallel yet
interconnected routes. One is to ascertain me human genome,
the total genetic makeup of the human being; this involves
the reading of a code that although written with just four
letters (A-G-C-T, short for the initials of the names given to
the four nucleic acids that make up all DNA) is made up of
coundess combinations of those letters mat men form
"words" that combine into "sentences" and "paragraphs"
and finally a complete "book of life." The other research
route is to determine the function of each gene; that is an
even more daunting task, facilitated by the fact that if that
very same gene ("genetic word") can be found in a simpler
creature (such as a lowly bacterium, or a laboratory mouse)
and its function could be experimentally determined, it is
virtually certain that the same gene in humans would have
the same functions (or its absence the same malfunctions).
The discovery of genes related to obesity, for example, has
been achieved that way.

The ultimate goal of this search for the cause, and thus
the cure, of human ailments and deficiencies is twofold: to
find the genes that control the body's physiology and those
that control the brain's neurological functions. To find the
genes that control the process of aging, me cell's internal
clock of the span of life — the genes of longevity — and the
genes that control memory, reasoning, intelligence. Experi-
ments on laboratory mice on the one hand and on human
twins on the other hand, and extensive researches in between,
indicate the existence of genes and groups of genes that ac-
count for both. How tedious and elusive these research tar-
gets are can be illustrated by the conclusion of a search for
an "intelligence gene" by comparing twins: the researchers
concluded that there might be as many as 10,000 "gene

The Cosmic Connection: DNA 119

sites" or "genetic words" responsible for intelligence and
cognitive diseases, each playing a tiny part by itself.

In view of such complexities, one wishes that modern
scientists would avail themselves of a road map provided
by — yes! — the Sumerians. The remarkable advances in as-
tronomy keep corroborating the Sumerian cosmogony and
the scientific data provided in the Epic of Creation: the ex-
istence of other solar systems, highly elliptic orbital paths,
retrograde orbits, catastrophism, water on the outer planets —
as well as explanations for why Uranus lies on its side, the
origin of the Asteroid Belt and of the Moon, the Earth's
cavity on one side and the continents on the other side. All
is explained by the scientifically sophisticated tale of Nibiru
and the Celestial Battle.

Why not then take seriously, as a scientific road map,
the other part of the Sumerian creation tales — that of the
creation of The Adam?

The Sumerian texts inform us, first of all, that the "seed
of life" — the genetic alphabet — was imparted to Earth by
Nibiru during the Celestial Battle, some four billion years
ago. If the evolutionary processes on Nibiru began a mere
one percent before they were launched on Earth, evolution
there had begun forty million years before it started on Earth.
It is thus quite plausible that the advanced superhumans, An-
unnaki, were capable of space travel half a million years ago.
It is also plausible that when they came here, they found on
Earth the parallel intelligent beings still at the hominid stage.

But coming from the same "seed," transgenic manipula-
tion was possible, as Enki had discovered and then sug-
gested. "The being we need already exists!" he explained.
"All we need to do is put our [genetic] mark on it."

One must presume that by then the Anunnaki were aware
of the complete genome of the Nibiruans, and capable of
determining no less of the hominids' genome as we are by
now of ours. What traits, specifically, did Enki and Ninmah
choose to transfer from me Anunnaki to the hominids? Both
Sumerian texts and biblical verses indicate that while the first
humans possessed some (but not all) of the longevity of the

120 THE COSMIC CODE

Anunnaki, the creator couple deliberately withheld from The
Adam the genes of immortality (i.e. the immense longevity
of the Anunnaki that paralleled Nibiru's orbital period). What
defects, on the other hand, remained hidden in the depths of
the recombined genome of The Adam?

We strongly believe that were qualified scientists to
study in detail the data recorded in the Sumerian texts,
valuable biogenetic and medical information could be ob-
tained. An amazing case in point is the deficiency known as
Williams Syndrome. Afflicting roughly one in 20,000 births,
its victims have a very low IQ verging on retardation; but at
the same time they excel in some artistic field. Recent re-
search has discovered that the syndrome resulting in such
"idiot savants" (as they are sometimes described) is caused
by a minute gap in Chromosome 7, depriving the person of
some fifteen genes. One of the frequent impairments is the
inability of the brain to recognize what the eyes see — im-
paired eyesight; one of the most common talents is musical.
But that is exactly the instance recorded in the Sumerian
text of the man with impaired eyesight whom Enki taught
to sing and play music!

Because The Adam could not, at first, procreate (requiring
the Anunnaki to engage in cloning), we must conclude that
at that stage the hybrid being possessed only the basic
twenty-two chromosomes. The types of ailments, deficiencies
(and cures) that modem biomedicine should expect to find
on those chromosomes are the types and range listed in the
Enki and Ninmah texts.

The next genetic manipulation (echoed in the Bible in the
tale of Adam and Eve in the Garden of Eden) was the grant-
ing of the ability to procreate — the addition of the X (female)
and Y (male) chromosomes to the basic 22 (Fig. 44). Con-
trary to long-held beliefs that these two chromosomes have
no other function besides determining the offspring's sex,
recent research has revealed that the chromosomes play
wider and more diverse roles. For some reason this aston-
ished the scientists in particular regarding the Y (male) chro-
mosome. Studies published at the end of 1997 under

The Cosmic Connection: DNA

121

if! ifi »i

• C *

"S "fl "6 "'
,g »g ^ ng

* ■ il

Figure 44

scientific headings as "Functional Coherence of the Human
Y Chromosome" received bold headlines in the press such
as "Male Chromosome Is Not a Genetic Wasteland. After
All" (the New York Times, October 28, 1997). (These dis-
coveries confirmed, as an unexpected bonus, that "Adam,"
too, like Eve, had come out of southeastern Africa).

Where did Enki — the Nachash — obtain the X and Y chro-
mosomes? And what about the source of the mtDNA? Hints
scattered in the Sumerian texts suggest that Ninki, Enki's
spouse, played some crucial role in the final stage of human
creation. It was she, Enki decided, who would give the hu-
mans the final touch, one more genetic heritage:

The newborn's fate,
thou shalt pronounce;

122 THE COSMIC CODE

Ninki would fix upon it
the image of the gods.

The words echo the biblical statement that "in their image
and after their likeness did the Elohim create The Adam."
And if indeed it was Ninki, Enki's spouse and mother of
Marduk, who was the source of the mtDNA of "Eve," the
importance attached to the sister-wife lineage begins to make
sense; for it constituted one more link to Man's cosmic or-
igins.

Sumerian texts assert that while the gods kept "Eternal
Life" to themselves, they did give Mankind "Wisdom," an
extra dose of intelligence genes. That additional genetic con-
tribution, we believe, is the subject of a text that scholars
call The Legend of Adapa.

Clearly identified in the text as a "Son of Eridu," Ea/
Enki's "cult center" in the Edin, he was also called in the
text "the son of Ea" — an offspring, as far as other pieces
of data suggest, of Ea/Enki himself by a woman other than
his spouse. By dint of this lineage, as well as by deliberate
action, Adapa was recalled for generations as the Wisest of
Men, and was nicknamed the Sage of Eridu:

In those days, in those years,

Ea created the Sage of Eridu

as a model of men.

Wide understanding he perfected for him,

disclosing the designs of the Earth.

To him he had given Widsom;

Eternal Life he had not given him.

This clash between Fate and Destiny takes us to the mo-
ment when Homo sapiens-sapiens appeared; Adapa, too, be-
ing the son of a god, asked for immortality. That, as we know
from the Epic of Gilgamesh, could be obtained by ascending
heavenward to the abode of the Anunnaki; and that was what
Ea/Enki told Adapa. Undaunted, Adapa asked for and re-
ceived Enki's "road map" for reaching the place: "He made

The Cosmic Connection: DNA 123

Adapa take the way to heaven, and to heaven he ascended."
Enki provided him with correct instructions of how to gain
admittance to the throne room of Anu; but also gave him
completely wrong instructions on how to behave when he
would be offered the Bread of Life and the Water of Life.
If you accept them and partake of them, Enki warned Adapa,
surely you shall die! And, so misled by his own father.
Adapa refused the food and the waters of the gods and ended
up subject to his mortal's Destiny.

But Adapa did accept a garment that was brought to him
and wrapped himself in it, and did take the oil that was of-
fered to him, and anointed himself with it. Therefore, Anu
declared, Adapa would be initialed into the secret knowledge
of the gods. He showed him the celestial expanse, "from the
horizon of heaven to heaven's zenith." He would be allowed
to return to Eridu safe and sound, and there would be initi-
ated by the goddess Ninkarrak into the secrets of "the ills
that were allotted to Mankind, the diseases that were wrought
upon the bodies of mortals," and taught by her how to heal
such ailments.

It would be relevant here to recall the biblical assurances
by Yahweh to the Israelites in the wilderness in Sinai. Wan-
dering three days without any water, they reached a watering
hole whose water was unpotable. So God pointed out to
Moses a certain tree and told him to throw it into the water,
and the water became potable. And Yahweh said to the Is-
raelites: If you shall give ear to my commandments, 1 shall
not impose on thee the illnesses of Egypt; "I Yahweh shall
be thine healer" (Exodus 15:26). The promise by Yahweh
to act as the healer of his chosen people is repeated in Exodus
23:25, where a specific reference is made to enabling a
woman who is barren to bear children. (That particular prom-
ise was kept in regard to Sarah and other female heroines of
the biblical narrative).

Since we are dealing here with a divine entity, it is safe
to assume that we are dealing here also with genetic healing.
The incident with the Nefilim, who had found on the eve of
the Deluge that the "Daughters of The Adam" were com-

124 THE COSMIC CODE

patible, and sufficiently so to be able to have children to-
gether, also involves genetics.

Was such knowledge of genetics, for healing purposes,
imparted to Adapa or other demigods or initiates? And if
so — how? How could the complex genetic code be taught to
Earthlings in those "primitive" times?

For the answer, we believe, we have to search in letters
and in numbers.

SECRET KNOWLEDGE,
SACRED TEXTS

Science — the understanding of the workings of the heavens
and the Earth — was the gods' possession; so did the ancient
peoples unequivocally believe. It was a "secret of the gods,"
to be hidden from Mankind or revealed, from time to time
and only partly, to selected individuals — initiates into the
divine secrets.

"Everything that we know was taught to us by the gods,"
the Sumerians stated in their writings; and therein lies the
foundation, throughout the millennia and unto our own times,
of Science and Religion, of the discovered and the occult.

First there was the Secret Knowledge; what was revealed
when Mankind was granted Understanding became Sacred
Wisdom, the foundation of human civilizations and advance-
ment. As to the secrets that the gods had kept to mem-
selves — those, in the end. proved the most devastating to
Mankind. And one must begin to wonder whether the unend-
ing search for That Which Is Hidden, sometimes in the guise
of mysticism, stems not from the wish to attain the divine
but from a fear of what Fate the gods — in their secret con-
claves or in hidden codes — have destined for Mankind.

Some of the knowledge that was, or could be. imparted to
Mankind when Wisdom and Understanding were granted can
be gleaned from God's challenge to Job regarding what he
does not know (but God does). "Say if thou knowest sci-
ence," the biblical Lord stated to the suffering Job:

Who has measured the Earth,
that it be known?

125

126 THE COSMIC CODE

Who has stretched a cord upon it?
By what were its platforms wrought?
Who has cast its stone of corners?

Wherefrom cometh Wisdom.

and where is Understanding located?

Mortals know not its arraignment.

in the Land of the Living it is not found.

The ways thereof to Elohim are known,

God knows the place thereof;

For he sees to the ends of the Earth

and all that is under the Heavens he views.

With such words did the biblical Lord challenge Job (in
chapter 28) to stop questioning the reasons for his Fate, or
its ultimate purpose; for Man's knowledge — Wisdom and
Understanding — fall so far short of God's, that it serves no
purpose to question or try to fathom divine will.

That ancient treatment of Wisdom and Understanding of
the secrets of the heavens and the Earth — of science — as a
divine domain to which only a few selected mortals can be
given access, found expression not only in canonical writings
but also in such Jewish mysticism as the Kaballah, according
to which the Divine Presence symbolized by God's Crown
rests on the penultimate supports designated Wisdom (Hokh-
mah) and Understanding (Binah) (Fig. 45). They are the
same two components of scientific knowledge regarding
which Job had been challenged.

The references to Hokhmah ("Wisdom") in the Old Tes-
tament reveal mat it was considered to have been a gift from
God, because it was the Lord of the Universe who possessed
the Wisdom required for creating the heavens and the Earth.
"How great are thy deeds, Oh Lord; with Wisdom hast thou
wrought them all," Psalm 104 states as it describes and ex-
tols, phase by phase, the Creator's handiwork. When the
Lord granted Wisdom to selected humans, the Bible held, He

Secret Knowledge, Sacred Texts

127

it

^^

Figure 45

in fact shared with them secret knowledge concerning the
heavens and the Earth and all that is upon the Earth. The
Book of Job described such knowledge as '"Wisdom's Se-
crets," which had not been revealed to him.

Revelation, the sharing of secret knowledge with human-
ity through chosen initiates, began before the Deluge.
Adapa, the offspring of Enki to whom Wisdom and Under-
standing (but not Eternal Life) were granted, was shown by
Anu the expanse of the heavens not merely as a sightseeing
thrill. Post-Diluvial references to him attributed to him the
authorship of a work known by its English title Writings Re-
garding Time, [from] Divine Anu and Divine Enlil — a trea-
tise that dealt with time reckoning and the calendar. The

128 THE COSMIC CODE

Tale of Adapa, on the other hand, specifically mentions that
he was taught, back in Eridu, the arts of medicine and heal-
ing. He was thus a well-rounded scientist, adept in both ce-
lestial and earthly subjects; he was also anointed as the
Priest of Eridu — perhaps the first to combine Science and
Religion.

Sumerian records spoke of another, pre-Diluvial Chosen
One who was initiated into the divine secrets by being taken
up to the celestial abode of the Anunnaki. He came from
Sippar ("Bird City") where Utu/Shamash was in charge, and
was probably an offspring of his, a demigod. Known in the
texts as EN.ME.DUR.ANNA as well as EN.ME.DUR.AN.KI
("Master of the Divine Tablets Concerning the Heavens" or
"Master of the Divine Tablets of the Bond Heaven-Earth"),
he, too, was taken aloft to be taught secret knowledge. His
sponsors and teachers were the gods Utu/Shamash and Ish-
kur/Adad:

Shamash and Adad [clothed? anointed?] him,
Shamash and Adad set him on a large golden throne.
They showed him how to observe oil and water,
a secret of Anu, Enlil and Ea.

They gave him a divine tablet,

the Kibbu, a secret of Heaven and Earth.

They placed in his hand a cedar instrument,

a favorite of the great gods.

They taught him to make calculations with numbers.

Though the Tale of Adapa does not say so explicitly, it
appears that he was allowed, if not actually required, to share
some of his secret knowledge with his fellow humans, for
else why would he compose the renowned book? In the case
of Enmeduranki the transmission of the learned secrets was
also mandated — but with the stricture that it must be limited
to the line of priests, from father to son, begun with Enme-
duranki:

Secret Knowledge, Sacred Texts 129

The learned savant

who guards the secrets of the great gods

will bind his favored son with an oath

before Shamash and Adad.

By the Divine Tablet, with a stylus,

he will instruct him in the secrets of the gods.

The tablet on which this text has been inscribed (now kept
in the British Museum) has a postscript: '"Thus was the line
of priests created, those who are allowed to approach Sha-
mash and Adad."

The Bible also recorded the heavenward ascent of the pre-
Diluvial patriarch Enoch — the seventh of the ten listed, as
was Enmeduranki in the Sumerian King List. Of that extraor-
dinary experience the Bible only says that, at age 365, Enoch
was taken aloft to be with God. Fortunately, the extrabiblical
Book of Enoch, handed down through the millennia and sur-
viving in two versions, provide much greater detail; how
much is originally ancient, and how much was fancy and
speculation when the "books" were compiled close to the
beginning of the Christian era, one cannot say. But the con-
tents are worth summarizing, if for no other reason than for
the affinity to the Enmeduranki tale, and because of a briefer
but still much more extensive narrative in another extrabibl-
ical book, the Book of Jubilees.

From these sources it emerges that Enoch made not one
but two celestial journeys. On the first one he was taught the
Secrets of Heaven, and was instructed to impart the knowl-
edge on his return to Earth to his sons. Ascending toward
the Divine Abode, he was lofted through a series of heavenly
spheres. From the place of the Seventh Heaven he could see
the shape of the planets; in the Eighth Heaven he could dis-
cern constellations. The Ninth Heaven was the "home of the
twelve signs of the zodiac." And in the Tenth Heaven was
the Divine Throne of God.

(It should be noted here that the abode of Anu, according
to Sumerian texts, was on Nibiru, which we have identified
as a tenth planet of our Solar System. In Kabbalah beliefs.

130

THE COSMIC CODE

Figure 46

the way to the abode of God Almighty led through ten Se-
firot, translated '"brilliances" but actually depicted as ten
concentric spheres — Fig. 46 — in which the central one is
named Yessod ("Foundation"), the eighth and the ninth
Binah and Hokhmah, and the tenth Ketter, the "Crown" of
the God Most High. Beyond that stretches Ein Soff. "Infin-
ity").

Accompanied by two angels, Enoch arrived at his final
destination, God's Abode. There his earthly garments were
removed; he was clothed in divine garments and anointed by
the angels (as was done to Adapa). On the Lord's command,
the archangel Pravuel brought out "the books from the sa-
cred storehouse" and gave him a reed stylus with which to
write down what the archangel would dictate to him. For
thirty days and thirty nights Pravuel dictated and Enoch
wrote down "the secrets of the workings of heaven, of the
Earth and of the seas: and of all the elements, their passages

Secret Knowledge, Sacred Texts 131

and goings, and the thunderings of the thunder; and [the se-
crets] of the Sun and the Moon, and the goings and chang-
ings of the planets; the seasons and the years and the days
and the hours . .. and all the things of men, the tongues of
of every human song ... and all the things fit to learn."

According to the Book of Enoch, all that vast knowledge,
"secrets of the Angels and God," was written down in 360
sacred books, which Enoch took back with him to Earth.
Summoning his sons, he showed them the books and ex-
plained their contents to them. He was still talking and in-
structing when a sudden darkness fell and the two angels
who had brought Enoch back lifted him and returned him to
the heavens; it was precisely the day and hour of his 365th
birthday. The Bible (Genesis 5:23-24) simply states: "And
all the days of Enoch were three hundred and sixty and five
years; and Enoch walked with God, and he was no more, for
he was taken by Elohim."

A prominent similarity between all three tales (Adapa, En-
meduranki, and Enoch) is the involvement of two divine be-
ings in the celestial experience. Adapa was met at the Gate
of Anu, and accompanied in and out, by the two young gods
Dumuzi and Gizidda; Enmeduranki's sponsors/teachers were
Shamash and Adad; and Enoch's, two archangels. The tales
undoubtedly were the inspiration for an Assyrian depiction
of Anu's heavenly gate, in which it is guarded by two Ea-
glemen. The gate bears the symbol of Nibiru, the Winged
Disc, and the heavenly location is indicated by the celestial
symbols of the Earth (as the seventh planet), the Moon, and
the complete Solar System (Fig. 47).

Another aspect that stands out — though not explicitly so
in the case of Enoch — is the tradition that the granting of the
Wisdom and Understanding made the chosen individual not
just a scientist but also a priest, and moreover the progenitor
of a priestly line. We find this principle employed in the
Sinai wilderness during the Exodus, when Yahweh, the bib-
lical Lord, chose Aaron (the brother of Moses) and his sons
to be the Lord's priests (Exodus 28:1). Already distinguished
by belonging to the tribe of Levi — both on the father's and

132

THE COSMIC CODE

h*

Figure 47

the mother's sides (Exodus 2:1) — Moses and Aaron were
initiated into magical powers that enabled them to perform
miracles as well as trigger the calamities mat were meant to
convince the Pharaoh to let the Israelites leave. Aaron and
his sons were then sanctified — "upgraded" in current par-
lance — to become priests endowed with considerable Wis-
dom and Understanding. The Book of Leviticus sheds light
on some of the knowledge that was granted to Aaron and
his sons; it included secrets of the calendar (quite complex,
since it was a lunar-solar calendar), of human maladies and
healing, and veterinary knowledge. Considerable anatomical
information is included in the relevant chapters of Leviticus,
and the possibility that the Israelite priests were given
"hands-on" lessons cannot be ruled out in view of the fact
that clay models of anatomical parts, inscribed with medical
instructions, were current in Babylon even before the time
of the Exodus — Fig. 48.

(The Bible described King Solomon as the "wisest of
men" who could discourse on the biodiversity of all the
plants, "from cedars of Lebanon to the hyssop that grows
out of a wall, and animals, and birds, and creeping things,
and fishes." He could do so because in addition to the Wis-
dom and the Understanding (intelligence) that were God-
given, he also acquired Da'ath — learned knowledge).

The priestly line begun with Aaron was subjected to rig-

Secret Knowledge, Sacred Texts

133

Figure 48

orous laws imposing marital and procreation constraints.
Whom they could have conjugal relations with and especially
whom they could marry required that "the priestly seed shall
not be profaned," and if one's seed shall be imperfect —
"shall have a blemish," a mutation, a genetic defect — that
man was prohibited through all generations to perform
priestly duties, "for I Yahweh hath sanctified the priestly
line" of Aaron.

These strictures intrigued generations of biblical scholars;
but their true significance became evident only with me ad-
vent of DNA researches. It was only in January 1997. in the
journal Nature, that an international group of scientists re-
ported the existence of a "Priestly Gene" among Jews
whose lineage can be traced back to Aaron. Unchanged Jew-
ish traditions require that certain rituals and blessings called
for on the Sabbath and High Holidays services must be per-

134 THE COSMIC CODE

formed only by a Cohen. The term, meaning "priest," was
first used in the Bible to describe Aaron and his sons. Ever
since then, the designation has been passed down through
the generations from fathers to sons, and the only way to
become a Cohen is to be born as a son of one. This privileged
status has been as often as not identified by using "Cohen"
as a family name (transmuted into Kahn, Kahane, Kuhn) or
as an adjective added after a person's name, so and so Ha-
Cohen, "the priest."

It was this aspect of the patrilineal nature of the Jewish
Cohen tradition that intrigued a research team from Israel.
England. Canada, and the USA. Focusing on the male ("Y")
chromosome that is passed from father to son. they tested
hundreds of "Cohens" in different countries and found that
by and large they had two unique "markers" on the chro-
mosome. This proved to be the case both for Ashkenazi (East
European) and Sephardi (Near Eastern/African) Jews who
had branched out after the destruction of the Jerusalem Tem-
ple in A.D. 70, indicating the antiquity of the genetic markers.

"The simplest and most straightforward explanation is
that these men have the Y chromosome of Aaron, " explained
Dr. Karl Skorecki of the Israel Institute of Technology in
Haifa.

The tales of those who were initiated into the secret
knowledge assert that the information was written down in
"books." These, for sure, were not what we now call
"books" — inscribed pages bound together. The many texts
discovered in caves near the Dead Sea in Israel are referred
to as the Dead Sea scrolls, for they were texts inscribed on
sheets of parchment (made mostly of goat skins) sewn to-
gether and rolled to form scrolls, the way the Scrolls of the
Law (the first five books of the Hebrew Bible) are inscribed
and rolled to this day. The biblical Prophets (especially Eze-
kiel) featured scrolls as part of the divinely given messages.
Ancient Egyptian texts were written on papyrus — sheets
made from reeds growing in the Nile River. And the earliest
known texts, from Sumer, were inscribed on clay tablets;

Secret Knowledge, Sacred Texts 135

using a reed stylus, the scribe would make markings on a
piece of wet clay that, after it dried, would become a hard
inscribed tablet.

In which form were the "hooks" written by Adapa, En-
meduranki, and Enoch (360 of them by the latter!)? Bearing
in mind that they are attributed to a time before the Deluge —
thousands of years even before the Sumerian civilization —
probably in none of the post-Diluvial forms, although the
Assyrian king Ashurbanipal did boast that he could read
"writing from before the Flood." Since in each instance
what was written down was dictated by the divine Lord, it
would be logical to wonder whether the writing was done in
what some Sumerian and Akkadian texts call Kitab Hani —
"writing of the gods." References to such writings by the
Anunnaki may be found, for example, in inscriptions dealing
with the rebuilding of run-down temples, in which the claim
was made that the reconstruction followed "the drawings
from olden times and the writing of the Upper Heaven." The
Sumerians listed a goddess. Nisaba (sometimes spelled Ni-
daba), as the patron goddess of scribes and the one who kept
the records for the gods; her symbol was the Holy Stylus

One of the references to writings of the gods in the earliest
times is found in a Hittite text dubbed by scholars The Song
of Ullikuimnis. Written on clay tablets that have been dis-
covered in the ancient Hitdte capital Hattushas (near the
present-day village of Boghaskoy in central Turkey), it
relates a puzzling tale of a "vigorous god made of diorite
stone" that an ancient god whom the Hittite named Kumar-
bis had fashioned in order to challenge the other gods. The
challenged gods, unable to withstand or counter the chal-
lenger Ullikummis, rushed to Enki's abode in the Lower
World to obtain from him the hidden "old tablets with the
words of fate." But after the "ancient storehouse" was
opened, and the "olden seals" with which the tablets were
secured were removed, it was discovered that the writing was
in "the olden words," requiring the Olden Gods to under-
stand them.

In Egypt it was Thoth who was venerated as the Divine

136 THE COSMIC CODE

Scribe. It was he who, after the Council of the Gods resolved
to recognize Horus as the legitimate heir, inscribed on a
metal tablet me Decree of the Gods, and the tablet was then
lodged in the "divine Chamber of Records." In addition to
records for divine use. Thorn was also credited by the Egyp-
tians with writing books for the guidance of mortals. The
Book of the Dead, they held, was a composition "written by
Thoth with his own fingers" as a guide to the Journey in the
Afterlife. A shorter work called by the Egyptians the Book
of Breathings also contained the statement that it was Thoth
who "had written this book with his own fingers." And in
the Tales of the Magicians, to which we have already re-
ferred, it was said that the living but inanimate king and
queen whom Thoth had punished guarded, in the subterra-
nean chamber, "the book that the god Thoth has written with
his own hand" and in which secret knowledge concerning
me Solar System, astronomy, and the calendar was revealed.
When the seeker of such "ancient books of sacred writings"
penetrated the subterranean chamber, he saw the book "giv-
ing off a light as if the Sun shone there."

What were those divine "books" and what kind of writing
was on them?

The epithet-name of Enmeduranna, "Master of the Divine
Tablets Concerning Heaven," draws attention to the term
ME in his name, translated here as "Divine Tablets." In
truth no one can be sure what the ME's were, whether tablets
or something more akin to computer-memory chips or discs.
They were objects small enough to be held in one hand, for
it was told that Inanna/Ishtar, seeking to elevate her city Uruk
to capital status, connivingly obtained from Enki scores of
the ME's that were encoded with the secrets of Supreme
Lordship, Kingship, Priesthood, and other aspects of a high
civilization. And we recall that the evil Zu stole from Enid's
Duranki the Tablets of Destinies and the ME's which were
encoded with the Divine Formulas. Perhaps we will grasp
what they were if we look to technology millennia ahead.

Putting aside me question of me gods' own writings and
data-keeping for their own purposes, the issue of what Ian-

Secret Knowledge, Sacred Texts 137

guage and what writing system were used when secret
knowledge was dictated to Earthlings for use by Earthlings
becomes a matter of great significance when it comes to the
Bible — and especially so in regard to the events on Mount
Sinai.

Paralleling the tale of Enoch staying in the heavenly abode
"thirty days and thirty nights'* taking dictation, is the bib-
lical report of Moses, having ascended toward the Lord God
atop Mount Sinai, "stayed there with Yahweh forty days and
forty nights — bread he did not eat and water he did not
drink — and he wrote upon the tablets the words of the Cov-
enant and the Ten Commandments" as God dictated (Exodus
34:28).

Those, however, were the second set of tablets, replacing
the first set that Moses smashed in anger when he had come
down from Mount Sinai a previous time. The Bible provides
greater — and mind-boggling — details regarding that first in-
stance of sacred writings: then, the Bible explicitly states.
God himself did the inscribing!

The tale begins in chapter 24 of the book of Exodus, when
Moses and Aaron and two of his sons, and seventy of the
Elders of Israel, were invited to approach Mount Sinai on
the peak of which the Lord had landed in his Kabod. There
the dignitaries could glimpse the divine presence through a
thick cloud, blazing as a "devouring fire." Then Moses
alone was summoned to the mountaintop, to receive the To-
rah ("Teachings") and the Commandments that the Lord
God had already written down:

And Yahweh said unto Moses:

Come up to me upon the Mount

and remain there,

and I will give thee the stone tablets —

the Teachings and the Commandments —

that I had written

so that you may teach them.

Exodus 24:12

138 THE COSMIC CODE

"And Moses went into the midst of the cloud, and as-
cended the Mount; and he stayed there forty days and forty
nights." Then Yahweh

Gave to Moses,

when He had finished speaking with him.

the two Tablets of Testimony —

stone tablets.

inscribed with the finger of Elohim.

Exodus 31:17

Additional astounding information regarding the tablets
and the manner in which they were inscribed is provided in
Exodus 32:16-17 that describe the events that took place as
Moses was coming down the Mount after a long and (to the
people) inexplicable absence:

And Moses turned to come down from the Mount,
and the two Tablets of the Testimony in his hand —
tablets inscribed on both their sides,
inscribed on the one side and on the other side.
And the Tablets were the handiwork of Elohim,
and the writing was the writing of Elohim.
and it was engraved upon the tablets

Two tablets made of stone, divinely handcrafted. In-
scribed front and back in the "writing of the Elohim" —
which must mean both language and script; and so
engraved into the stone by God himself!

And all that in a language and in a script that Moses could
read and understand, for he was to teach all that to the Is-
raelites ...

As we know from the rest of the biblical record. Moses
smashed the two tablets when, reaching the encampment, he
saw that in his absence the people made a golden calf to be
worshiped in imitation of Egyptian customs. When the crisis
was over,

Secret Knowledge, Sacred Texts 139

Yahweh said unto Moses.

Hew thyself two tablets of stone

like the first two ones.

and I shall write upon these tablets

the words which were on the first tablets

that thou hast broken.

Exodus 34:1

And Moses did so and went up the Mount again. There
Yahweh came toward him, and Moses bowed and repeated
his pleas for forgiveness. In response, the Lord God dictated
to him additional commandments, saying: "Write thee these
words down, for in accordance with them did I make a Con
enant with thee and with the people of Israel." And Moses
stayed on the Mount forty days and forty nights, recording
on the tablets "the words of the Covenant and the Ten Com-
mandments" (Exodus 35:27-28). This time. Moses was tak-
ing down dictation.

Not only the sections in Exodus. Leviticus, and Deuter-
onomy recording the Teachings and Commandments, but all
of the first five books of the Hebrew Bible (the above plus
Genesis and Numbers) have been deemed, from the very be-
ginning, to be sacred writings. Embraced by the general term
Torah. they are also known as the Five Books of Moses,
because of the tradition that Moses himself wrote or authored
all five of them as a divine revelation to him. Therefore, the
Torah scrolls that are taken out of their ark in synagogues
and read on the Sabbath and High Holidays must be copied
(by special scribes) precisely the way they have come down
through the ages — book by book, chapter by chapter, verse
by verse, word by word, letter by letter. An error of one
letter disqualifies the whole five-book scroll.

While this letter-by-letter precision has been studied by
Jewish sages and biblical scholars throughout the ages (long
before the latest interest in "secret codes" in the Torah). an
even more challenging aspect of the long and extensive dic-
tation and the required letter-by-letter accuracy has been
completely ignored:

140 THE COSMIC CODE

And that is, that such a method of writing upon Mount
Sinai could not have been the slow cuneiform script of
Mesopotamia that was usually written with a stylus on
wet clay, nor the monumental hieroglyphic picturelike
script of Egypt. The volume and speed and the letter-by-
letter accuracy required an alphabetic script!

The problem is that at the time of the Exodus, circa 1450
B.C., nowhere in the ancient world did an alphabetic script
yet exist.

The concept of an alphabet is the work of genius; and
whoever the genius was, he based it on existing foundations.
Egyptian hieroglyphic writing advanced from picture-signs
depicting objects to signs standing for syllables or even con-
sonants; but it has remained a complex writing system of
countless picture-signs (see Fig. 24b). Sumerian writing ad-
vanced from its original pictographs to cuneiform (Fig. 49)
and the signs acquired a syllabic sound; but to form from
them a vocabulary required hundreds of different signs. The
genius combined cuneiform ease with Egyptian advances to
consonants, and achieved it with just twenty-two signs!

Starting with that, the ingenious inventor asked himself as
well as his disciple: What is the word for what you see? The
answer — in the language of the Semitic Israelites — was Aluf.
Fine, said me inventor: Let us call this symbol Aleph and
simply pronounce it M A." He then drew the pictograph for
house. What do you call that? he asked, and the disciple
answered: Bayit. Fine, said the inventor, from now on we
will call this sign "Beth" and pronounce it simply as "B."

We cannot vouch that such a conversation actually took
place, but we are certain that this was the process of creating
and inventing the Alpha-Bet. The third letter, Gimel (pro-
nounced "G") was the image of a camel (Gamal in He-
brew); the next one, Daleth for "D," represented Deleth,
"door" (on its hinges); and so on through the twenty-two
letters of the Semitic alphabet (Fig. 50), all of which serve
as consonants and three of which can double up as vowels.

Who was the ingenious innovator?

Secret Knowledge, Sacred Texts

141

•

Origin*!

Iltll

i *

fiw-

•Kr:-

Maine

con

•'■»!■
•1.. .

&

§

4

■

tmrtk

<r

<M

o5i

a2
a

K

>J»

>»l»fji»

*

V

&

(&Bki

4&&to>

H

x*

j*-

Ejp

V

>

O

* _:*»

*-

f

}

<2=r

«fe*

iAC

■».

*r

m

=5

I?

8

A

Iktir

f

if

ov

CB±,

<tH

MB

trii*

»ttf

<p

E

Pd

F^

•U

So

^r

e*

^

$

*

M

riak

*

i

Xf

X>

^

sue

an
imag

^

&

¥

*»-

♦

l«rl«T

*

*

Figure 49

If one is to accept the learned opinion, it was some manual
laborer, a slave in the Egyptian turquoise mines in the west-
ern Sinai, near the Red Sea, because it was there that Sir Hin-
ders Petrie found in 1905 signs carved on walls that, a decade
later, Sir Alan Gardiner deciphered as "acrophonic" — spell-
ing out L-B-A-L-T (Fig. 51); it meant Dedicated "To the
Mistress" (presumably the goddess Hathor) — but in Semitic,
not Egyptian! Further similar writings discovered in that
area left no doubt that the alphabet originated there; from

142

THE COSMIC CODE

A-iciant Htbra*

Slnat

Aieph

H

^

Ink

3 5

in

Gia.1

•\

>

r*ielh

^ a

"to-

Ha

M

*

fm

Y

Zayln

■3=-

Hath 1 1)

a U

kl

Tath

Yod

-v

^

>;:a~:

JLZ*

$3

(2) Tranacrlbad "S"
Tor alttpllclty, tha
S la prcmounead ai
"tT" or "Ea."

Figure 50

(1> Tranacrlbad "H"
for iimpUcltj. tha
M 1* pronouoead in

SuBtrlart and Semitic
at "ch" lit Seettlah
"Lech."

96 -*

Lsiaad

CI

Wt0&\

Has

") ?

*-*

«™

5 4

Saaekh

£S

<=&

Aylr,

oo

1 p *

WJ

-v

Sad* (2)

*/*-*l

Oo

Koph

f¥T

^

Keah

1

t^J 1

Shin

w

+

Tav

X

there it spread to Canaan and then to Phoenicia (where an
attempt to express the ingenious idea with cuneiform signs —
Fig. 52 — was short-lived). Beautifully executed, the original
"Sinaitic script" served as the Temple script in Jerusalem
and as the royal script of Judean kings (Fig. 53a) until it

Secret Knowledge, Sacred Texts 143

Figure 5 1

was replaced, during the time of the Second Temple, with a
square script borrowed from the Aramaeans (the script used
in the Dead Sea scrolls unto modern times, Fig. 53b).

No one has really been comfortable with the attribution of
the revolutionary innovation, at the end of the Bronze Age,
to a slave in turquoise mines. It required an outstanding
knowledge of speech and writing and linguistics, apart from
outstanding Wisdom and Understanding, that could hardly
have been possessed by a mere slave. And what was the
purpose of inventing a new script when, in the very same
mining areas, monuments and walls were filled with Egyp-
tian hieroglyphic inscriptions (Fig. 54)? How could an ob-
scure innovation in a restricted area spread to Canaan and
beyond and replace there a writing method that had existed
and served well for more than two millennia? It just does
not make sense; but in the absence of another solution, that
theory still stands.

But, if we have imagined right the conversation that

144 THE COSMIC CODE

5.TI mfc^T ^^fffc<T/Trr

j

Figure 52

had led to this alphabet, then it was Moses to whom the
first lesson was given. He was in the Sinai; he was there
at the right time; he engaged in extensive writings; and
he had the supreme teacher — God himself.

Little noticed in the biblical tales of Exodus is the fact that
Moses was instructed by Yahweh to write things down even
before the ascent upon Mount Sinai to receive the tablets.
The first time was after the war with the Amalekites, a tribe
that instead of acting as an ally betrayed the Israelites and
attacked them. The betrayal, God said, should be remem-
bered by all future generations: "And Yahweh said unto
Moses: Write this down in a book for a remembrance"
(Exodus 17:14). The second mention of a book of writings
occurs in Exodus 24:4 and 24:7, in which it is reported that
after the Lord God. speaking in a booming voice from atop
the Mount, listed the conditions for an everlasting Covenant
between Him and the Children of Israel, "Moses wrote down
all the words of Yahweh. and built an altar at the foot of the
Mount and erected twelve stone pillars according to the num-
ber of the tribes of Israel." And then "he took the covenant
book and read from it to the people to hear."

The dictating and writing down had thus begun before the
ascents of Moses to the mountaintop and the two separate
writings on the stone tablets. One has to look to the earlier
chapters of Exodus to find out when and where the alphabetic
innovation — the language and writing employed in the
Lord's communications with Moses — could have taken
place. There we read mat Moses, adopted as a son by the

Secret Knowledge, Sacred Texts

145

£**? >&* *!* "

^k*m&-

tgm Jton v Jinn wjwj ns ■rMWWJfer^^V^
W«* Q» iAgl W****** brtA^i f*****

fW

Figures 53a and 53b

Pharaoh's daughter, fled for his life after he had killed an
Egyptian official. His destination was the Sinai peninsula,
where he ended up dwelling with the Midianite high priest
(and marrying his daughter). And one day, shepherding the
flocks, he wandered into the wilderness where the "Mount
of the Elohim" was, and there be was summoned by God
out of the burning bush and given the task of leading his
people, the Children of Israel, out of Egypt.

Moses returned to Egypt only after the death of the Phar-
aoh who had sentenced him (Thothmes III, by our calcula-
tions), in 1450 B.C., and struggled with the next Pharaoh
(Amenophis II in our opinion) for seven years until the Ex-
odus was permitted. Having started to hear from the Lord

146

THE COSMIC CODE

.saCr*^ safe

Figure 54

God already in the wilderness, and then during the seven
years, there had thus been ample time to innovate and master
a new form of writing, one that was simpler and much faster
than those of the great empires of the time — Mesopotamian,
Egyptian, Hittite.

The Bible relates extensive communications between Yah-
weh and Moses and Aaron from the moment Moses had been
summoned to the burning bush onward. Whether the divine
messages, sometimes involving detailed instructions, were
ever in writing the Bible does not say; but it might be sig-
nificant that the "magicians" in the Pharaoh's court thought
that they had been written instructions: "And the Pharaoh's
magicians said to him: This is the finger of god" (Exodus
8:15). "The finger of God." it will be recalled, was the term
used in Egyptian texts regarding the god Thoth, to indicate
a writing by the god himself.

If all this leads to the suggestion that alphabetic writing

Secret Knowledge, Sacred Texts 147

began in the Sinai Peninsula — it should not be surprising that
archaeologists have reached that same conclusion, but with-
out being able to explain how such a tremendous and ingen-
ious innovation could have originated in a wilderness.

Did the conversation that we have imagined actually take
place, or did Moses invent the alphabet by himself? After
all, he was in the Sinai peninsula at the very same time, he
was highly educated in the Egyptian court (where correspon-
dence with both the Mesopotamians and Hittites had been
going on), and he undoubtedly learned the Semitic language
from the Midianites (if not knowing it already from his Is-
raelite brethren in Egypt). Did he, in his wanderings in the
Sinai wilderness, see the Semitic slaves (Israelites who had
by then been enslaved in Egypt), crudely etch on the mines'
walls his idea of a new way of writing?

One would have liked to be able to attribute the brilliant
innovation to Moses, acting alone; it would have been grat-
ifying to credit the biblical leader of the Exodus, the only
one who had'conversed with God person-to-person according
to the Bible, with the invention of the alphabet and the cul-
tural revolution it had triggered. But the repeated references
to Divine Writing, writing by God himself, and Moses only
taking dictation, suggest that the alphabetic writing and lan-
guage system were one of the "secrets of the gods" Indeed,
it was to the same Yahweh that the Bible attributed the in-
vention/innovation of other diverse languages and scripts on
a previous occasion — in the aftermath of the incident of the
Tower of Babel.

One way or another, we feel that Moses was the initiate
through whom the innovation was revealed to Mankind.
And thus we can rightly call it The Mosaic Alphabet.

There is more to the first alphabet as a "secret of the
gods." It is based, in our opinion, on the most sophisti-
cated and ultimate knowledge — that of the genetic code.

When the Greeks adopted the Mosaic alphabet a thousand
years later (though reversing it as a mirror image, Fig. 55),
they found it necessary to add more letters in order to allow

148

THE COSMIC CODE

Hal r*w

nan*

MAW

Ai«pii

H

A

A

Alptl*

A

iwt

3 5

S 3

1

Beta

B

Cwi

'\

1

r

*«M

CG

E»)«th

* ^

A

A

:«lt«

D

M

a A

1

6

Elfilior. 5

E

Mm

J

1

I

V.u

FV

I»yin

-* k

X

X

Z«ta

h»-t-h

* *

B

1

(HIlU

H

tut*

9

®

®

T7«t«

KM

V

^

J

Jot«

1

k"h*ph

t; ;>>

H

K

KWI

*-

£/

v-M

l^

Luti(U

L

H»

") ^

n

r*

w „

M

im

} 1

V!

H

Mj

N

'■*-*•!

ftl

£

s

Xi

X

AyiT!

O0

o

o

■"< r.;,r" '

O

P.

?j;

1

r

Fi

p

S*d*

i^-n.

K

M

■m

• -;• ■

-7*1

<p

9

KOfpl

Q

ItMB

1

<1

p

: J;

R

Shin

w

1

*

■ffW

5

T»T

X

T

T

T»v

T

Figure 55

for all the pronunciation needs. In fact, within the confines
of the twenty-two letters of the Mosaic-Semitic alphabet,
some letters can be pronounced as "soft" (V, Kh, S, Th) or
hard (B, K, SH, T); and other letters had to double up as
vowels.

Indeed, as we contemplate this limitation to twenty-two —
no more, no less — we cannot help recalling the constrictions
applied to the sacred number twelve (requiring the addition

Secret Knowledge, Sacred Texts 149

or dropping of deities in order to keep the "Olympian Cir-
cle" to precisely twelve). Did such a hidden principle — di-
vinely inspired — apply to the restriction of the original
alphabet to twenty-two letters'?

The number ought to be familiar in this day and age. It is
the number of human chromosomes when The Adam was
created, before the second genetic manipulation had added
the sex chromosomes " Y" and "X" !

Did the Almighty who had revealed to Moses the secret
of the alphabet, then, use the genetic code as the secret
code of the alphabet?

The answer seems to be Yes.

If this conclusion seems outlandish, let us read the Lord's
statement in Isaiah 45:11: "It is I who created the Letters
... It is I who made the Earth and created the Adam upon
it," thus sayeth Yahweh, the Holy One of Israel. Whoever
was involved in the creation of Man was involved in the
creation of the letters that make up the alphabet.

Present-day computer systems construct words and num-
bers from just two "letters," a Yes-No system of ones and
zeroes matching an On-Off flow of electrons (and thus called
binary). But attention has already shifted to the four-letter
genetic code and the much greater speed with which the
transactions take place within the living cell. Conceptually,
the present computer language that is expressed in a se-
quence such as 0100110011110011000010100 etc. (and in
countless variations using "0" and "1") can be envisaged
as the genetic language of a DNA fragment expressed as the
nucleotides CGTAGAATTCTGCGAACCTT and so on in a
chain of DNA letters (that are always arranged in three letter
"words") bound as base-pairs in which the A binds with T.
C with G. The problem and the challenge is how to create
and read computer chips mat are coafed not with "0" and
"1" electrons but with bits of genetic material. Advances
since 1991 at various academic institutions as well as at com-
mercial enterprises involved in genetic treatments have suc-
ceded in creating silicon chips coated with nucleotides
Comparing the speed and the capabilities of DNA Comput-

150

THE COSMIC CODE

CCATCGCTAAAGCG

iilllillilllllllll

GGTAGCGATTTCGCACCT

DNA transcribed
Into RNA

DNA

^

mtsf ngtr RNA

CCATCGC TAAAGCGTGGA

Figure 56

ing, as the new science is called, "the information storage
capacity of DNA is huge," a research paper published in
Science (October 1997) stated.

In nature, the genetic information encoded in the DNA is
decoded, at lightning speed, by a messenger called RNA that
transcribes and recombines the DNA "letters" into "words"
consisting of three letters. These three-letter groupings, it has
been established, lie at the core of all life forms on Earth
because they spell out chemically and biologically the twenty

Secret Knowledge, Sacred Texts 151

amino acids whose chains form the proteins of which all life
on Earth — and probably elsewhere in the cosmos — consists.
Figure 56 illustrates schematically, and in a simplified man-
ner, how a given DNA sequence is decoded and recombined
into the amino acids Propraline ("Pro"). Serine ("Ser"),
etc., by means of the three-letter word code to build a protein.

The rich and precise Hebrew language is based on "root"
words from which verbs, nouns, adverbs, adjectives, pro-
nouns, tenses, conjugations and all other grammatical vari-
ants derive. For reasons that no one has been able to explain,
these root words are made up of three letters. This is quite
a departure from the Akkadian, the mother-language of all
Semitic languages, which was formed from syllables — some-
times just one, sometimes two or three or more.

Could the reason for the three-letter Hebrew root
words be the three letter DNA-language — the very
source, as we have concluded, of the alphabet itself? If
so, then the three letter root words corroborate this con-
clusion.

"Death and life are in me language," the Bible states in
Proverbs (18:21). The statement has been treated allegori-
cally. It is time, perhaps, to take it literally: the language of
the Hebrew Bible and the DNA genetic code of life (and
death) are but two sides of the same coin.

The mysteries that are encoded therein are vaster than one
can imagine; they include among other wondrous discoveries
the secrets of healing.

HIDDEN CODES,
MYSTIC NUMBERS

It was probably inevitable that with the advent of the modern
computer age, some masters of the craft would turn their
capabilities to a novel and new goal: the search for a "secret
code" in the Bible.

While this is presented in scientific papers and even books
as the epitome of modern sophistication, the fact is that this
search is actually a renewed, not a new, search, albeit with
new and more advanced tools.

The Hebrew Bible consists of three parts, the Torah
("Teachings"), which comprises the Pentateuch (the Five
Books of Moses) and, historically and chronologically, covers
the time from Creation through the wanderings of the Exodus
and the death of Moses; Neviyim ("Prophets"), encompass-
ing the books of Joshua and the Judges, Samuel and the
Kings, and then the major and minor Prophets, the Psalms
and Proverbs and Job — historically from the Israelite settle-
ment in Canaan through the destruction of the First Temple
of Jerusalem; and Ketuvim ("Writings"), starting with the
Song of Songs through the books attributed to the two lead-
ers who led the exiles back to Judea to rebuild the Temple
(Ezra and Nehemiah) and (in the arrangement of the Hebrew
Bible's canon) ending with 1 and 2 Chronicles. All together
the three parts are called by the acronym TaNaKh; and it was
already in the time of the Prophets that interpretive refer-
ences to the first part, the Torah, were made.

Discussions by Jewish sages and religious leaders intended
to "read between the lines" of the words of the Torah, then
of the Prophets, intensified during the exile after the destruc-

152

Hidden Codes, Mystic Numbers 153

tion (by the Babylonian king Nebuchadnezzar) of the First
Temple, and even more so after the destruction of the Second
Temple (by the Romans). The record of those deliberations
is the Talmud ("The Study"). Jewish mysticism, known as
the Kaballah, took over and built upon those earlier searches
for hidden meanings.

That such hidden meanings did exist, the Bible itself at-
tests. The key was the alphabet, the twenty-two letters.

A simple encoding device, which even schoolchildren often
play, is the serial substitution of letters. Kabbalist sages in the
Middle Ages used as a search tool a system known as ATBSh,
in which the last letter of the Hebrew alphabet. Tav ("T") is
substituted for the first letter Aleph ("A"); the last but one,
Shin ("Sh") for the second Beth ("B"), and so on. The Kab-
balist Abraham ben Jechiel Hacohen illustrated the system and
provided the key to it in a book published in A.D. 1788.

But in fact such a coding system was used by the Prophet
Jeremiah (7th century B.C.) who. prophesying the fall of
mighty Babylon, substituted the spelling B-B-L (Babel) with
the letters Sh-Sh-Kh to avoid imprisonment (Jeremiah 25:26
and 51:42). The Book of Lamentations, attributed to the
Prophet Jeremiah, in which the fall and destruction of Jeru-
salem are bewailed, employed another hidden code, called
Acrostics, in which the first (or sometimes last) letter of a
verse make up a word or a name, or (as in the case of Jer-
emiah) reveal the identity of the sacred alphabetical letters.
The first word in the first verse (translated "alas") begins
with an Aleph, the second verse begins with a Beth and so
on through the twenty-second verse. The same acrostics is
repeated by the Prophet in the second chapter: then each
letter starts two verses in the third chapter, reverting to one
per verse in the fourth. Psalm 119 is constructed with eight-
fold acrostics!

The authenticity of certain verses in Psalms could be ver-
ified by noticing that each verse has two parts, each of which
starts alphabetically (e.g.. Psalm 145); the same clue is hid-
den in the verse arrangement of Proverbs 31. In Psalm 145,
moreover, the three verses (11, 12, 13) that extol the kingship

154 THE COSMIC CODE

of Yahweh begin with the letters Kh-L-M, which read back-
ward spell MeLeKh, "King."

The use of acrostics as a hidden code, evident in other
books of the Bible as well, is also found in post-biblical
books (some of which are included in the Christian arrange-
ment of the Old Testament). A prominent example comes
from the time of the revolt against Greek rule in the second
century B.C. The revolt bears the name of its leaders, the
Maccabees — a name which was in fact an acronym based on
the verse in the Song of Moses (Exodus 15:11) — "Who is
like thee among the gods, oh Yahweh" — the first letters of
the four Hebrew words forming the acronym M-K-B-I, pro-
nounced "Maccabee."

After the destruction of the Second Temple by the Romans
in A.D. 70, the spiritual and religious mainstay for the Jews
were the Holy Scriptures — the treasure of divine and pro-
phetic words. Was it all fated, was it all predicted? And what
is still destined, what is yet to come? The keys to the past
and to the future had to be hidden in the sacred writings, by
then canonized not only as to content but also as to every
word and every letter. That search for hidden meanings ob-
scured by secret codes became known after the Temple's
destruction as "entering the forbidden grove," the word for
"grove" — PaRDeS — in itself being an acronym created
from the first letters of four methods of extracting the scrip-
tures' message: Peshat (literal meaning), Remez (hint), Drash
(interpretation) and Sod (secret). A Talmudic tale intended
to illustrate the risks of dealing prematurely with what has
been meant to remain unrevealed relates how four rabbinic-
sages entered the Pardes; one "gazed and died," another lost
his mind, a third went wild and began to "uproot the
plants'": only one, Rabbi Akiba, came out whole.

The search for hidden meanings was resumed in Medieval
limes by the Kabbalists and their forerunners. What would
an examination of the Bible by the ATBSh code reveal?
What if another letter rearrangement is used? What if a word
is deemed inserted just to hide the real meaning, and thus
should be skipped to read the intended text? By such meth-

Hidden Codes, Mystic Numbers 155

ods, for example, one could prove that Psalm 92 ("A Song
for the Sabbath Day") was actually composed by Moses in
the Sinai, and not by King David. In another instance it was
asserted that the great Jewish savant Maimonides (Spain and
Egypt, twelfth century A.D.) was named in the Book of Ex-
odus, where the first letters of the last four words in verse
11:9 create the acronym R-M-B-M — matching the acronym
resulting from the full name of Maimonides, Rabbi Moshe
Ben Maimon (explaining the prevalent reference to him as
Rambam).

But, Medieval savants wondered, had the search to be lim-
ited to only first or last letters of words, the beginning or end
of verses? What happens if one searches for hidden meanings
by skipping letters? Every second, every fourth, every forty-
second? It was perhaps inevitable that with the advent of
computers, someone would apply this tool to an expedited
search for a "code" based on letter spacing. The latest spate
of interest in the subject indeed resulted from such an ap-
plication of computer techniques by a number of Israeli sci-
entists; it was launched by the publication in August 1994
of a paper titled "Equidistant Letter Sequences in the Book
of Genesis" in the prestigious journal Statistical Silence by
Doron Witzum, Eliyahu Rips and Yoav Rosenberg.

Subsequent reviews, analyses, and books (The Bible Code
by Michael Drosnin and The Truth Behind the Bible Code
by Jeffrey Satinover) deal, in essence, with one basic prem-
ise: If you list all of the 304,805 letters in the Pentateuch in
sequence, and arrange them in "blocs" that segment those
letters into sections consisting of a certain number of lines,
and each line a certain number of letters, then choose a skip-
ping method — certain letters will form words that, unbeliev-
able as it sounds, spell out predictions for our time and for
all time, such as the assassination of Prime Minister Rabin
of Israel or the discovery of the Theory of Relativity by
Albert Einstein.

However, in order to achieve such alleged "predictions"
of future events in texts written thousands of years ago, the
searchers had to devise arbitrary and changeable rules for

156 THE COSMIC CODE

how to read the "code words." The letters forming the pred-
ictory words end up sometimes lying next to each other,
sometimes spaced out (with the spacing varied and flexible),
sometimes read vertically, sometimes horizontally or diago-
nally, sometimes backward, sometimes from down up ...

Such arbitrariness in selecting the length and number of
lines, the direction of reading, the skipping or nonskipping
of letters and so on must rob the uninitiated of the uncritical
acceptance of the code claims that are based exclusively on
letters in the Bible: and to do that without belaboring the
issue of whether the current text of the Pentateuch is pre-
cisely the original, divinely endowed, letter-by-letter arrange-
ment. We say that not only because minor deviations
(example: writing certain words with a vowel-letter or
without one) had apparently occurred, but also because of
our belief (expounded in Divine Encounters) that there was
one more letter, an Aleph, at the beginning of Genesis. Apart
from the theological implications, the immediate issue is a
distortion of the letter count.

Nevertheless, the encryption of hidden words or meanings
into the biblical text must be accepted as a serious possibility,
not only because of the examples cited above, but for two
other very important reasons.

The first of them is that instances of encoding and en-
cryption have been found in non-Hebrew texts from Meso-
potamia, both from Babylonia and from Assyria. They
include texts that begin or end with the warning that they are
secret, to be shown only to the initiated (or, conversely, not
to be revealed to the uninitiated), under penalty of death in
the hands of the gods. Such texts sometimes employed de-
cipherable encoding methods (such as acronyms), and some-
times encrypting methods that remain an enigma. Among the
former is a hymn by the Assyrian king Ashurbanipal in
praise of the god Marduk and Marduk's spouse Zarpanit. It
uses the cuneiform syllabic signs at the beginning of lines to
spell out a hidden message to the god Marduk. Apart from
the acronymic encoding the king employed a second method

Hidden Codes, Mystic Numbers 157

of encryption: The syllables that formed the secret message
began on line 1, skipped line 2, used line 3, skipped line 4
and so on, skipping one line through line 9. Then the coded
message skipped two lines at a time, returning to a single
line skip on line 26, returning to a two-line skip from line
36, and then back to a one-line skip through the rest of the
tablet (including its reverse side).

[n this double-encoding, the Assyrian king spelled out the
following secret message to the god (we provide the trans-
lation horizontally, though the message in the tablet is read
vertically, from top to bottom):

A-na-ku Ah-shur-ba-an-ni-ap-li

I am Ashurbanipal

Sha il-shu bu-ul-ti-ta ni-shu-ma Ma-ru-du-uk

Who to his god called give me life Marduk [and]

Da-li-le-ka lu-ud-lu

I will praise thee

The discovery of an acrostic inscription by one Shaggil-
kinam-ubbib. a priest in the temple of Marduk in Babylon,
indicates not only the priesthood's accessibility to such en-
coding, but also raises questions regarding its antiquity. In
that acronym (in which there is an eleven-line skip between
the coded syllables) the encoder's name is clearly stated. As
far as is known, a priest by that name did serve in the Esagil
temple in Babylon circa 1400 B.C. That would date the con-
cept of encoding to about the time of the Exodus. Since most
scholars find mis early date too much to swallow, they prefer
to date it to the eighth century B.C. after all.

A somewhat different encoding method was used by the
Assyrian king Esarhaddon, Ashurbanipal's father. On a
stela mat commemorated a historic invasion by him of
Egypt (known to scholars as the Black Stone of Esarhad-
don, now in the British Museum — Fig. 57) he claimed mat
he had launched the military campaign not only with the
blessing of the gods, but also under the celestial aegis of
seven constellations that "determine the fates" — a certain

158

THE COSMIC CODE

Figure 57

reference to zodiacal constellations. In the inscription (on
the stela's back side) he claimed that the cuneiform signs
naming the constellations "are in the likeness of the writ-
ing of my name, Asshur-Ah-Iddin" (Asarhaddon or Esar-
haddon in English).

Exactly how this code or encryption worked is unclear;
but one can figure out another hidden meaning claimed by
this king in the same inscription. Dealing with the restoration
of Marduks temple in Babylon, which the Assyrian king
undertook as a way to be accepted also as a ruler of Baby-
lonia, he recalled that Marduk. having become angry at the
Babylonians, had decreed that the city and its temple shall
remain in ruins for seventy years. That was, Esarhaddon
wrote, what "Marduk wrote down in the Book of Fates."
However, responding to Esarhaddon's appeals,

Hidden Codes, Mystic Numbers

159

I

T

10 60

Figure 58

The merciful Marduk.

in a moment when his heart was appeased,

turned the tablet upside down

and, in the eleventh year,

approved the restoration.

What can be figured out regarding this hidden oracle is
that the god's act represented a sleight of hand with figures —
with the symbols (also in cuneiform) that stood for numbers.
In the Sumerian sexagesimal (meaning "base sixty") system,
the sign for "one" could mean both 1 and 60, depending on
position. The sign for 10 was a chevronlike symbol. What
Esarhaddon asserted was that the god took the Book of Fates.
on which the decreed period of desolation was "70" years
(Fig. 58a) and turned it upside down, so that the cuneiform
signs represented "11" (Fig. 58b).

The association of hidden messages and secret meanings
not with words alone but with numerals and numbers was
even more prominent in the writings of S argon II, the grand-
father of Ashurbanipal. During his reign (721-705 B.C.) he
established a new administrative-military capital on the Bite
of a village some twelve miles northeast of the ancient royal
capital and religious center Nineveh. His Assyrian name was

160 THE COSMIC CODE

Sharru-kin ("Righteous King") and he named the new city
Dur Sharrukin ("Fort Sargon" — an archaeological site now
known as Khorsabad). In the inscription commemorating this
achievement, he wrote that the mighty wall he had built
around the city was 16,283 cubits long, "which is the num-
ber of my name."

Such a use of numbers to encode word-syllables appears
in a text known as An Exaltation to Ishtar. where the wor-
shiper signed his name not with letters but with numbers:

21-35-35-26-41

the son of 21-1 1-20-42

The key to such numerical encodings remains undeci-
phered. But we have reason to believe that such Meso-
potamian encoding methods were known to the Hebrew
Prophets.

One of the most difficult passages in the Bible is the
prophecy of Isaiah about the time of Retribution, when "it
shall come to pass mat a great trumpet shall be blown, and
they shall return those who were lost in the land of Assyria
and those who were cast out to the land of Egypt, and they
shall bow down to Yahweh on the Holy Mount in Jerusa-
lem." At that time, Isaiah prophesied, confusion shall reign
and people will ask each other, "Who shall be given the
understanding" of the message which has somehow been
altered to hide its meaning:

For precept is upon precept,

precept is within precept;

Line is upon line.

line is with line —

A Utile here, somewhat there;

For with a confused

language
and in a strange tongue
will He address this people.

Isaiah 28: 10-11

Hidden Codes, Mystic Numbers 161

No one has really understood how a "precept upon pre-
cept" and "line with line" will result in a "confused lan-
guage" and a "strange tongue." The Hebrew words are Tzav
("order") and Kav ("line"), and have been rendered in more
modern English translations as "command" and "rule" re-
spectively (The New American Bible), "mutter" and "mur-
mur" (Tanakh, the Holy Scriptures), or even "harsh cries"
and "raucous shouts" (!) (The New English Bible).

What language could be confused, or its written signs
given a strange meaning, by changing the "order" and
a "line" here and there? It is our suggestion that what
the Prophet Isaiah — a contemporary of Sargon II and
Sennacherib — was talking about is the cuneiform script
of the Assyrians and the Babylonians!

It was of course not an unknown language; but as the verse
quoted above states, the message delivered in that language
could not be understood because it had been encoded by Kav
to Kav, by changing a "line" here and a "line" there,
thereby changing the "precept" of what the message was
saying. The changed Tzav ("order") hints at encryption
methods (like the A/T-B/Sh) using the changed order of the
loiters.

This suggested solution to the enigma of verses 28:10-11
can serve to explain the subsequent description by the
Prophet (29:10-12) of the inability of anyone to understand
the envisioned writings because "the words of the book have
become unto you as a book that has been sealed." The last
word, hatoom, is usually translated "sealed." but in the bib-
lical usage it had the connotation of "hidden." made a se-
cret. It was a term employed in the same sense as the
Mesopotamian encoded writings that were sealed from the
eyes of the uninitiated. It was so employed in the prophetic
Song of Moses (Deuteronomy 32:34) where God is quoted
as stating that the predetermined things to come are "a secret
with me hidden, stored and sealed within my treasures." The
term is also used in the sense of "hidden away" or "made
a secret" in Isaiah 8:17; and even more so in the Book of

162 THE COSMIC CODE

Daniel and its vision and symbolisms of tilings to come at
the End of Things.

Isaiah, whose prophecies were attuned to the interna-
tional arena and the encryption of royal messages of his
time, may have given away the very clue to the existence
of a "Bible Code." Three times he revised the word Ototh
("signs") mat is used in the Bible to denote divine or ce-
lestial signs to read Otioth — a plural of Oth that means both
"sign" and "letter," conveying the meaning of letters in his
prophecy.

We have already mentioned the reference by Isaiah to
Yahweh as the creator of the Letters (of the alphabet). In
verse 45:11 the Prophet, extolling the uniqueness of Yahweh,
states that it was Yahweh who "hath arrayed by letters that
which shall come to pass." And that such an arrayment was
encoded ought to be the way to understand the enigmatic
verse 41:23. Describing how the bewildered people of the
Earth seek to divine the future from the past, Isaiah quotes
them as begging God:

Tell us the letters backward!

Were the word the usual Ototh. it would have meant, "tell
us the signs back from the beginning of things." But the
Prophet has chosen — three times — to write Otioth, "letters."
And the clear request is to be enabled to understand the di-
vine plan by being shown the letters backward, as in a code,
in which the letters have been scrambled.

But as the Mesopotamian examples indicate, acrostics was
too simple a device, and the real encodement — still undeci-
phered in the case of Sargon II — relied on the numerical
values of cuneiform signs. We have already mentioned the
"secret of the gods" concerning their rank numbers — num-
bers which sometimes were written or invoked instead of the
gods' names. Other tablets in which Sumerian terminology
was retained even in Akkadian texts (many remaining ob-
scure because of breaks in the tablets) point to the early use

Hidden Codes, Mystic Numbers

163

K

1

a

2

3

3

1

4

n

5

i

6

t

7

n

8

D

9

i

10

3

jo

&

30

a

40

a

50

D

60

7

70

t

SO

X

»o

P

100

1

200

C

300

n

400

Figure 59

of numerology as a secret code, especially when the gods
were involved.

It is no wonder then that the letters of the Hebrew alphabet
were granted numerical values (Fig. 59) and that such values
played a much greater role in the encoding and the decoding
of secret knowledge than the letters by themselves. When the
Greeks adopted the alphabet, they retained the practice of
assigning numerical values to letters; and it is from Greek
that the art of and rules for the interpretation of letters, words
or groups of words by their numerical values was given the
name Gematria.

Beginning in the time of the Second Temple, the numer-
ological Gematria became a tool in the hands of scholars as
well as gnostics to pry out of the biblical verses and words
untold numbers of hidden meanings or bits of information,
or for drawing new rules where the biblical ones were in-

164 THE COSMIC CODE

complete. Thus, it was held that when a man took an oath
to be a Nazirite, the unspecified period of abstention should
be 30 days, because the defining word YiHYeH ("shall be")
in Numbers chapter 6 has the numerical value 30. Comparing
words and their implications by their numerical equivalents
opened up countless possibilities for hidden meanings. As an
example, it was suggested that Moses and Jacob had a similar
divine experience, because the ladder to heaven (Sulam in
Hebrew) that Jacob saw in the nighttime vision and the
mount (Sinai) on which Moses received the Tablets of the
Law had both the same numerical value, 130.

The employment of numerology and especially Gematria
to detect secret meanings reached a new height with the
growth of Jewish mysticism known as the Kabbalah during
the Middle Ages. In those searches special attention was
given to divine names. Paramount was the study of the name
by which the Lord God named himself to Moses, YHWH:
"I am whoever I will be, Yahweh is my name" (Exodus 3:
14-15). If added simply, the four letters of the divine name
(the Tetragammaton) amount to 26 (10+5+6+5); but under
more complex methods advocated by the Kabbalists, in
which the spelled-out names of the four letters (Yod, Hei,
Wav, Hei) were added up numerically, the total comes to 72.
The numerical equivalents of these numbers made up scores
of insightful other words.

(At the beginning of Christianity an Alexandrian sect held
that the name of the supreme and primordial creator was
Abraxas, the sum of whose letters equaled 365 — the number
of days in a solar year. The sect's members used to wear
cameos made of semiprecious stones, bearing the god's im-
age and name — as often as not equated with YaHU (short
for Yahweh) — Fig. 60. There is every reason to believe that
Abraxas stemmed from Abresheet, "Father/Progenitor of Be-
ginning," that we have proposed as the full first word, start-
ing with an "A," of Genesis, rather than the current Bresheet
which makes Genesis start with a "B." If Genesis indeed
had one more letter, the code sequencing now in vogue
would have to be reexamined).

Hidden Codes, Mystic Numbers

165

Figure 60

How much value should one attach to numerical codes
or meanings — a code inherent in the letters themselves
and not on arbitrary spacing between them? Because
such usages lead back to Sumerian times, were valid in
Akkadian times, and were deemed at all times to be "se-
crets of the gods" not to be revealed to the uninitiated,
and because of the link to DNA, we believe that numerical
codes are the secret code!

In fact, one of the most obvious (and thus, as in detective
tales, the most ignored) clues is the very term for "book."
SeFeR in Hebrew. Stemming from the root SFR, its deriva-
tions were the words for writer/scribe (Sofer), to tell (Lesa-
pher), a tale or story (Sippur), and so on.

But the very same root SFR also denoted everything
connected with numbers! To count was Lisfor, numeral
is Sifrah, number is Mispar, counting is Sephirah. In other
words, from the very moment that the three-letter root
words of the Hebrew emerged, to write with letters and
to count with numbers were considered one and the same.

Indeed, there are instances in the Hebrew Bible where the
meanings "book" and "number" were interchangeable, as
in 1 Chronicles 27:24 where, reporting a census conducted
by King David, the word "number" was used twice in the
same sentence, once to denote the number (of the people
counted) and then to mean David's book of records.

166 THE COSMIC CODE

Such a double meaning, and perhaps a triple meaning, has
challenged translators of verse 15 in Psalm 71. Seeking
God's help though he knows not all of God's miracles, the
Psalmist vowed to recount God's deeds of salvation and jus-
tice "although 1 know not Sefuroth." The King James ver-
sion translates the word as "numbers"; more modern
translations prefer the connotation of "to tell," — "tellings."
But in this unusual form, the Psalmist has included a third
meaning, that of "mysteries."

As times became more turbulent in Judea. with one revolt
(that of the Maccabees against Greek rule) followed by an-
other (against Roman oppression), the search for messages
of hope — Messianic bodings — intensified. The scanning of
earlier texts for coded numbers evolved into the use of num-
bers as secret codes. One of the most enigmatic and best
encrypted instances found its way into the New Testament:
The number of a "beast" encoded as "666" in the Book of
Revelation.

Here is Wisdom;

Let him that hath Understanding

fount the number of the beast,

for it is the Number of a Man;

And his number is six hundred and three score and six.

Revelation 13:18

The passage deals with Messianic expectations, the down-
fall of evil, and in its aftermath a Second Coming, the return
of the Kingdom of Heaven to Earth. Countless attempts have
been made over the millennia to decipher the numerical code
of "666" and thus understand the prophecy. The number
clearly appears in the early (Greek) manuscript of the book
whose full title is The Gospel According to St. John, which
begins with the statement "In the beginning was the Word,
and the Word was with God, and the Word was God" and
which is filled with numerical references. Using the numer-
ical values of the Greek letters (which follow closely the

D

n

Hidden Codes, Mystic Numbers 167

60
400

200

660

60

n

400

n

200

1

6

b 666

Figures 61a and 61b

Hebrew arrangement) and the methods of Gematria, it has
been suggested that the "beast" was the evil Roman empire
because the numerical value of LATEINOS was 666. Others
have suggested that the numerical code meant the evil em-
peror himself (Trajan) whose middle name, ULPIOS, also
added up numerically rendered to 666. Still another sugges-
tion was that the code was in Hebrew, standing for Neron
Qesar ("Nero the Emperor"), whose Hebrew spelling N-R-
W-N + Q-S-R also added up to 666; and so on, in a variety
of Gematria approaches both using straight addition as well
as triangulauon methods.

The possibility that the encoded secret of "666" is to be
uncovered in Hebrew rather than Greek or Roman word
meanings might well be the key to finally resolving the
enigma. We find mat 660 in Hebrew is the numerical equiv-
alent of SeTeR (Fig. 61a) — a hidden thing, an occult mystery;
it was employed in the Bible in connection with divine
Wisdom and Understanding that were hidden and occulted
from Man. To make it 666, the letter Wav (= 6) has to be
added (Fig. 61b), changing the meaning from a "secret" to
"his secret," SiTRO, "his hidden thing." Some find this
rendition of "his secret" to describe a "watery darkness"
where the Celestial Battle with Tiamat is recalled:

168 THE COSMIC CODE

The Earth shook and trembled,

the foundations of the hills were shaken ...

There went up smoke from his nostrils,

a devouring fire out of his mouth ...

He made darkness his secret,

by a watery darkness and celestial clouds covered.

Psalms 18:8-12

There are repeated references in the Bible to that Celestial
Battle, which in the Mesopotamian Epic of Creation took
place between Nibim/Marduk and Tiamat, and in the Bible
between Yahweh as the Primeval Creator and Tehom, a "wa-
tery deep." Tehom/Tiamat was sometimes spoken of as Ra-
hab, the "haughty one," or rendered with an inversion of
letters RaBaH ("the great one") instead of RaHaB. The
wording in Psalm 18 echoes a much earlier statement in Deu-
teronomy 29:19, in which the judgments of Yahweh "on the
last generation" are prophesied and described as a time when
"smoke shall go up from the nostrils" of God. That time of
final accounting is often referred to in the Bible by the adverb
Az — "then," at that particular future time.

If the author of Revelation, as is evident, also had in mind
that Az, that "then" at the time of the Last Generation, when
the Lord shall reappear as He had when Heaven and Earth
were created at the time of the battle with Tehom Rabah (a
term used in combination in Amos 7:4, Psalms 36:7, Isaiah
5:10), then a numerical approach to the enigma of the "666"
would suggest that the Book of Revelation was speaking of
the Return of the Celestial Lord in a reenactment of the Ce-
lestial Battle: for the sum total of the numerical value of Az
+ Tehom + Rabah is 666 (Fig. 62).

Such an attempt by us to decode the number "666" by
reconverting it into letters and then search for words con-
taining those letters in the Old Testament does not exhaust
the possibilities. The transmutation of Abresheet into
Abraxas (with its numerical value 365) as a gentile deity,
and the biblical references (earlier quoted) to encodements
in cuneiform writings by changing the lines in the cuneiform

Hidden Codes, Mystic Numbers 169

TX

Dinn

451

207

666

Figure 62

signs, as well as the reference to backward reading as well
as the A-T-B-Sh employment to hide identities of foreign
gods, raise the question: To what extent, especially as the
destiny of the Hebrews became entangled in the fate of other
nations and their gods, did biblical encodements actually hide
secret data from foreign writings and pantheons? If the cre-
ation tales of Genesis were actually shorter versions of the
creation secrets recorded in Enuma elish, what about those
secret portions that had been revealed to Enmeduranki and
Adapa (and Enoch)?

We read in Genesis that when the Pharaoh elevated Jo-
seph, who interpreted dreams, to high office, he gave him as
was appropriate to an Egyptian official a new. Egyptian
name: Zophnat-Pa'aneach. While scholars have attempted to
reconstruct the hieroglyphic writing and Egyptian meaning
of the epithet-name, what is obvious is that it was in reality
a name whose meaning was encoded in Hebrew, for in He-
brew it clearly meant "Solver" (Pa'aneach) of "Secret/Hid-
den Things" (Zophnot).

Such language/letter/number transfigurations reinforce the
question (and the possibility) — and not only in regard to the
reason for "666" — of whether the codes might have in-
cluded allusions to other deities of pantheons known in an-
tiquity.

One of the unexplained aspects of the Hebrew alphabet is

170 THE COSMIC CODE

ps -

1»

"S«cr«t Cod«"
(of> "Sixty**

D
1

1

60
6
4

70

Figures 63a, 63b and 63c

that five letters are written differently when their place is at
the end of a word (Fig. 63a). If we are to do our own ven-
turing into the Pardes, the "forbidden grove," and adopting
the premise of a combination letter+number code, we could
say that read in reverse (from left to right) the encoded rea-
son for these odd five letters is a "secret code" (Zophen) of
"60" (M+Kh), which is the secret number of Anu! (Fig.
63b).

If so, was it just a coincidence that the first letter in the
Hebrew word for "secret" — SOD — ("S") has the numeri-
cal value "60," and even more so that the numerical value
of the full word is "70" — the secret number of the desola-

Hidden Codes, Mystic Numbers 171

tion decreed by Marduk (and then reversed by him) for the
city of Babylon? And for that matter, was the statement (in
Jeremiah and elsewhere) that the desolation of Jerusalem and
its Temple would also last the exact same 70 years — a proph-
ecy that, when announced, was presented as a revelation of
a secret, a Sod, of God? (Fig. 63c).

An approach that accepts the possibility that the Old Tes-
tament as well as the New Testament borrowed for their en-
codings from earlier Mesopotamian secret writings and
divine rankings leads to another possible solution of the
"666" enigma.

One of the rare (discovered) instances where the number
"6" was revealed as a divine rank was in a tablet that was
put together by Alasdair Livingstone in Mystical and Myth-
ological Explanatory Works of Assyrian and Babylonian
Scholars. The reconstructed tablet — which bears the admo-
nition regarding the undisclosable secrets it contains — begins
with 60 as the rank of "the preeminent god, father of the
gods" and then, in a separate column, reveals his identity:
Anu. Followed by Enlil (50), Ea/Enki (40), Sin (30) and
Shamash (20), it lists Adad, the "god of rain and thunders,"
as "6." As the listing continues on the obverse as well as
the reverse sides, it lists "600" as the secret number of the
Anunnaki.

What emerges from that Mesopotamian tablet regarding
the secret numbers of the gods may well have the key to
finally solving the mystery of "666" by looking at it as a
Sumerian-based encoding:

600 = The Anunnaki, "Those Who From Heaven to
Earth Came"

60 = Anu, their supreme ruler
6 = Adad, one of the gods who teaches Initiates

666 = "Here is Wisdom," "Counted by him who has
Understanding"

(The proximity of Anu and Adad beginning in the second
millennium B.C. found not only textual expressions but also

172 THE COSMIC CODE

in their having joint temples. Incredible as it may sound, the
Bible, too, lists Anu and Adad next to each other in a list of
gods of "other nations" — 2 Kings 17:31).

The secret numbers of the gods can serve as clues to the
deciphering of secret meanings in other divine names. Thus,
when the alphabet was conceived, the letter "M" — Mem.
from Ma'yim, water, paralleled the Egyptian and Akkadian
pictorial depictions of water (a pictograph of waves) as well
as the pronunciation of the term in those languages for "wa-
ter." Was it then just a coincidence that the numerical value
of "M" in the Hebrew alphabet was "40" — the secret nu-
merical rank of Ea/Enki, "whose home is water," the pro-
totype Aquarius?

Was there an equally secret numerical code that has orig-
inated in Sumer for YaHU — the shortened form for the Te-
tragammaton YaHWeH? Were one a Sumerian initiate
seeking to apply the secret numbers code to this theophoric
name (as used in prefixes and suffixes to personal names),
one could say that YHU is a secret code for "50" (IA =
10, U = 5, IA.U = 10x5 = 50), with all the theological
implications thereof.

While attention has been focused on the meaning of
"666," we find in the cryptic verse in Revelation a statement
of utmost significance. The secret code, it states, is what
Wisdom is all about, and it can be deciphered only by those
who have Understanding.

These are precisely the two terms used by the Sume-
rians, and those who came after them, to denote the se-
cret knowledge that only privileged initiates had been
taught by the Anunnaki.

At the foundation of the incredible and encompassing Su-
merian knowledge lay an equally amazing knowledge of
numbers. As the Assyriologist-mathematician Herman V.
Hilprecht observed earlier this century after the discovery of
numerous Mesopotamian mathematical tablets (The Babylo-
nian Expedition of the University of Pennsylvania), "all the

Hidden Codes, Mystic Numbers 173

multiplication and division tables from the temple libraries
of Nippur and Sippar, and from the library of Ashurbanipal
in Nineveh, are based upon the number 12960000" — a vir-
tual astronomical number, a number that required astounding
sophistication to be comprehended, and whose utility to hu-
mans in the fourth millennium B.C. seemed completely ques-
tionable.

But analyzing this number — with which some mathemat-
ical tablets started — Professor Hilprecht concluded that it
could only be related to the phenomenon of Precession — the
retardation of the Earth in its orbit around the Sun that takes
25,920 years to complete (until the Earth returns to the exact
same spot). That complete circling of the twelve houses of
the zodiac has been named a Great Year; the astronomical
number 12.960,000 represented 500 such Great Years. But
who, except for the Anunnaki, could grasp or have use for
such a vast span of time?

In considering numerical and counting systems, the deci-
mal system ("base ten") is the most obviously "man-
friendly," resulting from counting on the fingers of our
hands. Even the perplexing Mayan calendar system culled
Haab, which divided the solar year into 18 months of 20
days each (plus 5 special days at year's end) can be assumed
to have resulted from counting all 20 human digits, fingers
and toes combined. But from where did the Sumerians take
the sexagesimal ("base 60") system whose lasting expres-
sion is still extant in time reckoning (60 minutes, 60 sec-
onds), astronomy (a celestial circle of 360 degrees), and
geometry?

In our book When Time Began we have suggested that the
Anunnaki, coming from a planet whose orbital period (one
year on Nibiru) equaled 3,600 orbits of the planet Earth,
needed some kind of a common denominator for such diverse
periods — and have found one in the phenomenon of Preces-
sion (which only they, not men with the shorter life spans
dictated by Earth's cycles, could have discovered). When
they divided the celestial circle into twelve parts, the preces-

174 THE COSMIC CODE

Figure 64

sional retardation — that could be easily observed by them —
was 2,160 years per "house." That, we have suggested, led
to the ratio of 3,600:2,160 or 10:6 (the eventual Golden Ratio
of the Greeks), and to the sexagesimal system that ran 6 x
10 x 6 x 10 and so on (resulting in 60, 360, 3600 and so
on to the immense number 12,960,000).

In this system, several numbers of celestial or sacred im-
port seem to be out of place. One is the number seven, whose
significance in the story of Creation, as the seventh or Sab-
bath day, in the name of Abraham's abode Beer-Sheba
("The Well of Seven") and so on is easily recognized. In
Mesopotamia it was applied to the Seven Who Judge, the
Seven Sages, the seven gates of the Lower World, the seven
tablets of Enuma elish. It was an epithet of Enlil ("Enlil is
Seven," the Sumerians stated); and — undoubtedly the origin
of the number's significance — it was the planetary number
of Earth. "Earth (KI) is the seventh." all Sumerian astro-
nomical texts asserted. This, as we have explained, made
sense only to someone coming into the center of our Solar
System from the outside. To him (or them) coming from the
far-out Nibiru, Pluto would be the first planet, Neptune and
Uranus the second and third, Saturn and Jupiter the fourth
and fifth, Mars would be the sixth and Earth the seventh (and
then Venus the eighth — as indeed these planets were de-
picted on monuments and cylinder seals, Fig. 64).

(In Sumerian hymns to Enlil, "the all-beneficent," he was
credited with seeing to it that there was food and well-being
in the land; he was also invoked as the guarantor of treaties

Hidden Codes, Mystic Numbers 175

and oaths. No wonder, then, that in Hebrew the root from
which seven stems — Sh-V-A — is the same root from which
the meanings "to be satiated" and "to swear, to take an
oath" derive).

The number "7" is a key number in Revelation (7 angels,
7 seals, and so on); so was the next extraordinary number —
12 — or multiples thereof, 144,000 in Revelation 7:3-5, 14:1
etc. We have already recounted its applications and its sig-
nificance, as stemming from the number of the members of
our Solar System (Sun, Moon, and 10 planets — the 9 we
know of plus Nibiru).

And then — hardly realized — was the peculiar number 72.
To say, as has been done, that it is simply a multiple of 12
by 6, or that when multiplied by 5 it results in 360 (as the
number of degrees in a circle), is merely to state the obvious.
But why 72 to begin with?

We have already observed that the mystics of the Kaballah
arrived through Gematria methods at the number 72 as the
numerical secret of Yahweh. Although obscured in the bib-
lical report of the time when God instructed Moses and
Aaron to approach the Holy Mount and to take along 70 of
the elders of Israel, the fact is that Moses and Aaron had 72
companions: In addition to the 70 elders, God instructed that
2 sons of Aaron also be invited (although Aaron had 4
sons) — making the total 72.

Of all places we also find this odd number 72 in the Egyp-
tian tale dealing with the contending of Horus and Seth. Re-
lating the tale from its hieroglyphic sources, Plutarch (in De
hide et Osiride, wherein he equated Seth with Typhon of
Greek myths) said that when Seth tricked Osiris into the
doomed chest, he did so in the presence of 72 "divine com-
rades."

Why then 72 in these various instances? The only plau-
sible answer, we believe, is to be found in the phenome-
non of Precession, for it is there that the crucial number
72 is to be found, as the number of years it takes to retard
the Earth by one degree.

To this day it is not certain how the concept of a Jubilee

176 THE COSMIC CODE

had come about, the 50-year period decreed in the Bible and
used as the time unit in the Book of Jubilees. Here is the
answer: to the Anunnaki, whose one orbit around the Sun
equaled 3,600 Earth years, the orbit passed through 50 pre-
cessional degrees (50 x 72 = 3,600)!

It was perhaps more than a coincidence that Enlil's secret
rank number — and the number sought by Marduk — was also
50. For it was one of the numbers that expressed the rela-
tionships between Divine Time (stemming from Nibiru's mo-
tions), Earthly Time (relating to the motions of the Earth and
its Moon), and Celestial Time (or zodiacal time, resulting
from Precession). The numbers 3,600, 2,160, 72, and 50
were numbers that belonged to the Tablets of Destinies in
the heart of Nippur's DUR.AN.KI; they were truly numbers
expressing the "Bond Heaven-Earth."

The Sumerian King List asserts that 432,000 years (120
orbits of Nibiru) had passed from the arrival of the Anunnaki
on Earth until the Deluge. The number 432,000 is also key
in the Hindu and other concepts of Ages and the periodic
catastrophies that befall the Earth.

The number 432,000 also embraces 72 precisely 6,000
times. And it is perhaps worth keeping in mind that ac-
cording to Jewish sages the count of years in the Jewish
calendar — 5,758 in A.D. 1998 — will come to a completion,
a terminus, when it reaches 6,000; it is then that it will
all come full cycle.

As is evident from the ancient records concerning such
initiates — Adapa, Enmeduranna, Enoch — the core of the
knowledge and understanding revealed to them, no matter
what else, was astronomy, the calendar, and mathematics (the
"secret of numbers"). Indeed, as a review of the encoding
and encrypting practices in antiquity has shown, the common
thread between them, no matter what language used, was
numbers. If there was once a single universal language on
Earth (as the Sumerian texts and the Bible assert), it had to
be mathematically based; and if — or rather, when — we com-
municate with extraterrestrials, as had once been done with

Hidden Codes, Mystic Numbers 177

the Anunnaki on their visits here, and as we shall do when
we venture into space — the cosmic language will be one of
numbers.

In fact, current computing systems have already adopted
a universal numbers language. When in typewriters the key
for "A" was pressed, a lever holding this letter was activated
and it struck the paper with an "A." In the computers, when
the key for "A" is pressed, an electronic signal is activated
that expresses the "A" as a series of "0" or "1" numbers —
the letters have been digitized. Modern computers have, in
other words, converted letters into numbers; and one can say
that they have Gematriatized writing.

And if one takes seriously the Sumerian and biblical state-
ments about the inclusion of medical knowledge in the
Knowledge and Understanding passed on to us — is there
somewhere in all the ancient texts, so meticulously copied
with precision because they had been "canonized," the key
to sharing with us the genetic knowledge that went into our
creation, and thus still accompanies us in health and in sick-
ness and in death?

We have reached the point where our scientists have iden-
tified a specific gene — calling it, say, P5I — at a specific site
on chromosome number 1 or 13 or 22, that is responsible
for a trait or malady. It is a gene and a location that can be
expressed on computers — now as numbers, or wholly in let-
ters, or in combinations thereof.

Is there already in those ancient texts, and especially
the Hebrew Bible, such coded genetic information? If we
could only decipher such a code, we could become beings
like the "Perfect Model" that Enki and Ninharsag had
intended to create.

PROPHECY: WRITINGS
FROM THE PAST

Mankind's enduring belief that someone in the past could
foresee the future — that, in Sumerian parlance, someone had
known Destiny and could determine Fate — was founded
upon the Written Word. Revealed or secret, straightforward
or encrypted, the information had to be recorded, written
down. A covenant, a treaty, a prophecy — what value to those
then present or to those who will inhabit the future unless
the words be written down?

When archaeologists excavate an ancient site, nothing is
deemed more exciting and significant than "something"
with writing on it — an object, a brick, a stone slab, pottery
shards, and needless to say a text or part thereof inscribed
on a clay tablet or a papyrus sheet. What was the place, what
was its ancient name, to what culture did it belong, who were
its rulers? A few scribbled letters, a couple of words offer
answers; and so much more, of course, fuller texts.

One of the earliest antiquarians, if not a full-fledged ar-
chaeologist, was the Assyrian king Ashurbanipal. Believing
that his own fate and the land's Destiny were determined
way back in the past, he made written records from the past
the prime prize or booty of his conquests; and the library of
his palace in Nineveh was at the time (seventh century B.C.)
perhaps the greatest collection of clay tablets of countless
ancient texts of "myths" and epics, royal annals, and what
was then the "books" (on clay tablets) of astronomy, math-
ematics, medicine, and other invaluable texts. The tablets
were carefully arranged on wooden shelves, and each shelf
began with a catalogue tablet listing what was on that shelf.

178

Prophecy: Writings from the Past 179

In all a tremendous treasure of ancient knowledge, records,
and prophecy was assembled there. A great many of the texts
now known come from the tablets, or fragments thereof,
found in Nineveh. At the same time, the catalogue tablets at
the start of each shelf also reveal how much is still missing
and undiscovered.

Certainly missing — for none has been duplicated else-
where — are what Ashurbanipal himself identified as "writ-
ings from before the Deluge'"; we know that they had existed
because Ashurbanipal had boasted that he could read that
writing.

The king's assertion, one might note here, has not been
taken seriously by modern Assyriologists. Some have
amended the king's statement to read "writings in Sume-
rian," for it seems incredible not only to claim that there had
been writing millennia before Mesopotamian tablets, but that
such writing (on whatever tablets) had survived the global
catastrophe.

Yet other texts and sources, unrelated to Ashurbanipal or
his time, make those very assertions. Adapa — a pre-Diluvial
initiate — wrote a book whose title, rendered in Sumerian,
was U. SAR Dingir ANUM Dingir ENULA (Writings Re-
garding Time [from] divine Anu and divine Enlil).

Enoch, another pre-Diluvial ancestor, returned from
heaven with 360 "books" — a number not only with a ce-
lestial/mathematical allusion, but one, let us point out,
which when converted into letters spells out SeQeR
(60+100+200) — "that which is hidden." The name-place
Saqqarah in Egypt, the "hidden place" of early royal pyr-
amids and burials, stems from the same root.

The Book of Enoch (known as 1 Enoch) purports to have
been written by Enoch himself as a first-person report. Al-
though by all scholarly opinions it was compiled shortly be-
fore the Christian era, citations from it in other early works
and parallels with other extrabiblical writings (as well as the
fact that it was canonized in early Christian times), attest to
its being based on truly ancient texts. In the book itself, after
a brief introduction that explains who the Nefilim (of Genesis

180 THE COSMIC CODE

6 renown) were, Enoch states that what follows is "the book
of the words of righteousness and of the reprimand of the
eternal Nefilim" that were heard by him during a vision and
which he now proceeds to put down "in a human lan-
guage" — a language "which the Great One has given to men
to converse therewith."

Having been given knowledge of the heavens and the
Earth and their mysteries, Enoch was told to write down
prophecies of future events (according to the Book of Jubi-
lees, Enoch was shown "what was and what will be"). Al-
though scholars assume that the "prophecies" were really
hindsight, the incorporation in 1 Enoch of earlier texts and
its subseqent canonization attest that at the time of the Sec-
ond Temple it was firmly believed that the future could be
and was foretold in the past by divine inspiration — even dic-
tated by the Lord himself or his Angels to humans, to be
recorded and written down and passed to future generations.

Even more emphatic in asserting that Enoch brought down
with him books that contained not only scientific knowledge
but also prophecies of the future is the version known as 2
Enoch or by the full title The Book of the Secrets of Enoch.
It states that God instructed Enoch to "give the handwritten
books to his children" so that they may be handed down
"from generation to generation and from nation to nation."
Then God disclosed to him the "secrets of Creation" and
the cycles of the events on Earth. "At the beginning of the
eighth thousand of years there will be a time of Not-
Counting, [a time] with neither years nor months or weeks,
nor days or hours" (2 Enoch 33:1-2).

A reference is then made to even earlier writings that be-
longed to Enoch's ancestors Adam and Seth — "handwriting
that should not be destroyed till the end of time." There is
also reference to a "chart" that God has "put on Earth" and
"ordered that it be preserved, and that the handwriting of
thy fathers be preserved, and that it perish not in the Deluge
which I shall bring upon thy race."

The reference to a future Deluge, included in 2 Enoch as
a prophetic revelation by God to Enoch, thus speaks of

Prophecy: Writings from the Past 181

"handwritings" by both Adam and his son Seth and a divine
"chart" that were deposited on Earth and were to survive
the Deluge. If such "handwritings" ever existed, they must
be counted among the missing pre-Diluvial writings. At the
time of the Second Temple it was held that among such pre-
Diluvial writings were the Books of Adam and Eve. in which
many details were provided, augmenting the biblical tale.

Scholars agree that 1 Enoch has clearly incorporated, ver-
batim, sections from a much earlier manuscript called the
Book of Noah, a work that was mentioned in other writings
besides the Book of Enoch. It could well have been the
source of the very enigmatic eight verses in Genesis chapter
6; preceding the biblical version of the Deluge and its hero
Noah, those verses speak of the Nefilim, the "sons of the
Elohim" who had married the Daughters of The Adam as
the background for God's decision to wipe mankind off the
face of the Earth. In it, the tale is fully told, the Nefilim are
identified, the nature of the divine wrath is explained. Hark-
ing back in all probability to Sumerian times and sources, it
includes some details otherwise known only from the Me-
sopotamian Atra Hasis text.

It is more than likely that the two books mentioned
above — the Books of Adam and Eve and the Book of Noah —
did in fact exist, in one form or another, and were actually
known to the compilers of the Old Testament. After having
described the creation of The Adam and of Eve, and the
incident in the Garden of Eden and the birth of Cain and
Abel and then of Enosh, Genesis restarts (in chapter 5) the
genealogical record by saying, "This is the book of the gen-
erations of Adam" and recounts the creation tale. The He-
brew word translated "generations" (Toledoth) connotes
more than "generations" — it bespeaks "the histories of";
and the ensuing text gives the impression of a summary
based on some longer prior text.

The same term, Toledoth, starts the story of Noah and the
Deluge. Again translated "These are the generations of
Noah," the words really begin the story not so much of Noah

182 THE COSMIC CODE

as of the Deluge — a story based, without question, on earlier
Sumerian (and then Akkadian) texts.

Interesting and intriguing light on what the Book of Noah
might have contained is to be found in the Book of Jubilees,
another one of the Apocrypha (extrabiblical) books from the
time of the Second Temple (or earlier). It states that the An-
gels "explained to Noah all the medicines, all the diseases
and how he might heal them with herbs of the earth; and
Noah wrote down all things in a book, concerning every kind
of medicine." And after the Deluge, Noah "gave all mat he
had written to his son Shem."

Starting a new chapter not only in the Bible but in human
affairs again with the word Toledoth is next found in Genesis
chapter 10. Dealing with the post-Diluvial rimes, it begins,
"Now these are the 'generations' of the sons of Noah: Shem,
Ham and Japhet; and unto them were born sons after the
Deluge." The general list, nicknamed by biblical scholars
the Table of Nations, reverts to Shem and his descendants
and pays special attention to the line of his middle son Ar-
packhshad both in this chapter and by returning to the subject
in chapter 11 with the opening "These are the 'generations'
of Shem." The significance, we soon gather, is that it was
the direct ancestral line of Abraham's family.

The existence of a book that we might arbitrarily title The
Book of Shem or, more specifically, the Book of
Arpakhshad,

is suggested by yet another tradition concerning writings
from before the Deluge. The reference is found in the Book
of Jubilees: it informs us that Arpackhshad, a grandson of
Noah, was taught by his father Shem to write and read; and
seeking a place where to settle, "he found a writing which
former generations had carved on a rock, and he read what
was thereon, and he transcribed it." Among other informa-
tion "it included the teachings of the Nefilim concerning
how to observe the omens of the sun and the moon and the
stars and the signs of heaven." This description of the con-
tents of the writings by the Nefilim — and thus from before
the Deluge — parallels the wording in the Book of Enoch
about the knowledge of the Sun and the Moon and the stars/

Prophecy: Writings from the Past 183

planets that he was taught from "the heavenly tablets, and
all that was written thereon." All that Enoch passed on to
his son Metuselah, saying to him:

All these things I am recounting to thee

and writing down for thee;

I have revealed to thee everything

and given thee books concerning all this.

So preserve, my son Metuselah,

the hooks from thy father's hand

and deliver them to the generations of the world.

An unambiguous reference to pre-Diluvial writings and
what had happened to them as far as the destruction by the
avalanche of waters was concerned is found in the writings
of Berossus. A Babylonian historian-priest who compiled a
history of Mankind for the Greek rulers of the Near East
after the death of Alexander, he clearly had access to a li-
brary of ancient writings in Akkadian (and possibly in Su-
merian, too: In the first volume of his writings, describing
events from the splash landing of Ea to the Deluge, he called
the hero of the Great Flood by his Sumerian name, Ziusudra).
In the fragments of Berossus's writings that are available
from Greek historians, it is stated that after Ea/Enki had re-
vealed to Sisithros (= Ziusudra) that there would be a Del-
uge, "he ordered him to conceal every available writing in
Sippar, the city of Shamash. Sisithros accomplished all these
things, sailed immediately to Armenia, and thereupon what
the god had announced did happen." Those writings were
about "beginnings, middles, and ends."

Berossus continued to relate that among those who were
in the ark and survived the Deluge was Sambethe, the wife
of one of the sons of Ziusudra/Noah — her name probably a
corruption of the Sumerian or Akkadian Sabitu ("The Sev-
enth"). According to Berossus "she was the first of the Sy-
bils, and she had prophesied concerning the building of the
Tower of Babylon and all that happened to the enterprises

184 THE COSMIC CODE

of its planners; this was before the division of the lan-
guages."

To this first of a line of oracle prophetesses (the most
renowned of which was the Sybil in Delphi) was attributed
the role of intermediary between the gods and the survivors
of the Deluge. She uttered to them the words that were "a
voice from the air," which directed them how to survive
after the Deluge and "how to recover from Sippar the books
that described the future of Mankind."

The ubiquitous traditions and recollections regarding writ-
ings from before the Flood clearly persist in asserting that
apart from all manner of scientific knowledge they also in-
cluded prophecies concerning the future. As often as not,
such prophecies concerned not only fateful events that would
befall individuals or nations, but also humanity's and Earth's
ultimate destiny.

Enoch was shown "what was and what will be," and
wrote down for future generations the secrets of creation and
the cycles of events on Earth. God had placed a "chart" on
Earth, determining the destiny of the planet and all that is
upon it. The writings from before the Deluge were about
"beginnings, middles and ends."

Indeed, as one reviews the beliefs underlying all these di-
verse statements, one begins to understand why the editors
of Genesis in its Hebrew version had omitted the Aleph to
make the beginning start with Beginning, with a "B" (Beth).
For the very notion of a beginning incorporates within it a
notion of an end. The very admonition that the ancient writ-
ings, containing all that there is to be known — those ancient
"data banks," to use computer lingo — must be preserved
until the "end of times" or "end of days" implies that such
an end had been destined. By starting with beginning, the
Bible's editors subscribed to that belief.

These concepts permeate the Bible, from the very start in
Genesis through the books of the Prophets to the final books
(of the Hebrew Bible). "And Jacob called unto his sons, and
said: Come, gather, and I shall tell you that which shall befall

Prophecy: Writings from the Past 185

you at the end of days" (Genesis 49:1). Fearing that the
Israelites would abandon the commandments after his death.
Moses alerted them to the "evils that will befall you in the
last days" (Deuteronomy 31:29). Coupled with that admo-
nition was a prediction — a prophecy — of the Fate and future
of each one of the tribes of Israel. The prophetic visions of
Isaiah open with the statement, "And it shall be at the end
of days" (2:2); and the Prophet Jeremiah clearly explained
that what shall be "at the end of days" had been planned
"in Yahweh's heart" from the very beginning (23:20). "He
tells the End at the Beginning," Isaiah extolled the Lord God
(46:10).

God was the ultimate prophet and the source of all proph-
ecy. That biblical view found expression even where the text
seems just to report events. The punishment imposed on
Adam and Eve after they had eaten the forbidden fruit in me
Garden of Eden foresaw the future ways of human beings.
Cain was given a protective mark, for otherwise he and his
descendants would be avenged for seventy and seven gen-
erations. In a covenant made by God with Noah and his sons.
He promised mat mere would never again be a Deluge. In a
covenant with Abraham, God foretold his future as the father
of multitudes of nations; but predicted that a time would
come when his offspring would be enslaved in a foreign
land — a bitter experience that would last 400 years (as the
Israelite sojourn in Egypt eventually did). And regarding the
barren Sarah, God predicted that she would have a son and
that out of her womb there would come nations and kings
thereof.

Encompassing the human story from Adam and Eve
through me destruction of the First Temple of Jerusalem and
its rebuilding by returning exiles in the sixth century B.C.,
the Old Testament also tells, indirectly and almost unpercep-
tibly, the shift of prophecy from a direct communication
from God to one through Angels (literally: Emissaries) and
men through Prophets. Though Moses was designated a
Prophet of God, me universality of the phenomenon is re-
vealed by me biblical tale of Bile'am or Balaam. He was a

186 THE COSMIC CODE

renowned seer at the time of the Exodus, and was retained
by the Moabite king to curse the advancing Israelites; but
each time a place for the cursing and the rituals therefore
were prepared, Yahweh appeared to him and warned him not
to put a curse on His chosen people. After several attempts
he was persuaded by the Moabite king to try once more; but
then, in a divine vision, he could "hear the sayings of God
and discern the knowledge of the One who is Most High."
"Though not nigh, I can see it," Bala'am announced of the
Star of Jacob; "though not now, it steppeth forth." And that
is what the divine message is, he said: the Sons of Israel
shall defeat and conquer the nations standing in their way.
Incredibly, the list of those doomed nations included As-
syria — a nation not at all present in Canaan at the time of
the Exodus and whose kings assaulted only many centuries
later the Israelite kingdoms that were yet to be formed.

A case of prophecy based on past prophecies was the fu-
ture great battle of Gog and Magog that was revealed to the
Prophet Ezekiel (chapters 38 and 39) — a battle that in the
apocalyptic literature of the time assumed the role of the final
batde in the last millennium, the Armageddon of the New
Testament. Though in later writings Gog and Magog were
treated as two different persons or nations, Ezekiel speaks of
Gog as the ruler of the land Magog, and predicts that the end
of his domination shall come when he will attack the land
of Jerusalem, "the navel of the Earth." Predicting that this
shall take place at, and be a sign of, "the End of Days."
Yahweh declared through Ezekiel: Though thou shalt come
only at the end of days, Gog —

It is thou

of whom I had spoken

in the olden days

through the Prophets of Israel

who had prophesied in those days.

In those final times, Yahweh announced through Ezekiel,
there shall be a great earthquake and great destruction, and

Prophecy: Writings from the Past 187

plagues and bloodshed, and torrents of rains, and fire and
brimstones from the skies.

Another Prophet who recalled earlier prophets — the "First
Prophets" — was Zechariah (1:4, 7:7, 7:12), who also saw
the future in terms of the past, the so-called "First Days."
This was in line with all the biblical prophecies: in foretelling
the future, the Prophets asserted that the End was anchored
in the Beginning. Foreseeing the world's nations gathered
together to find out what is in store, the Prophet Isaiah en-
visioned them asking each other, "Who among us can tell
the future by letting us hear the First Things?" Mocking that
quest among the nations who ask about the past and the
future not God but each other. Isaiah declared that only Yah-
weh, the Lord of Hosts, has that knowledge (Isaiah chapter
43). That is further enlarged upon in Isaiah chapter 48,
wherein Yahweh announced:

It is I who had told the first things,
out of my mouth were they uttered.
And I shall announce them suddenly:
And when I shall do so, it shall happen.

The quest for the hidden past in order to divine the future
permeates not only the books of the Prophets but also the
biblical books of Psalms, Proverbs, and Job. "Give ear, my
people, to my teachings, incline your ears to the words of
my mouth; I will open my mouth with parables and will utter
riddles from olden times," the Psalmist (78:2-3) said of the
remembrances passed from generation to generation. Assert-
ing that he was qualified to address those riddles, he ex-
plained: "For I have taken count of the days of old and the
years of ancient times" (77:6).

This approach, of "Let's find out what has happened in
the past so that we might know what's coming," was based
on Mankind's experience throughout the millennia of human
memory — "myths" to most, recollections of actual events
to us. To anyone aware of the ancient tales — anyone not only
now but also in biblical times — it had to be obvious that at

188 THE COSMIC CODE

every twist and turn Mankind depended on the plans and
whims of its creators, the Elohim.

In the Beginning, we today and people (and certainly
Prophets) millennia ago have been informed that we have
come into being as a result of discussions in a council of the
gods, meeting to resolve a mutiny in the gold mines. Our
genetic makeup was determined as two Anunnaki — Enki and
Ninmah — acted both seriously and frivolously. It was at the
Council of the Great Gods that they voted and swore to bring
the creative experiment to an end and let Mankind perish in
the Deluge. And it was that, meeting in council, the Anun-
naki gods decided after the Deluge to give Mankind "King-
ship" in the three regions — the civilizations of Mesopotamia,
of the Nile Valley, and of the Indus Valley.

Curious about the records of the Beginnings, the human
story from Creation through the Deluge and the rise of na-
tions, the people of the last millennium B.C. — the time of the
biblical Prophets — also wondered about the Olden Days, the
events in the previous millennium or two — the time when
the Bible switched to Ur of the Chaldees in Sumer, and Abra-
ham, and the War of the Kings, and the upheaval of Sodom
and Gomorrah. Tell us of those Olden Days so that we would
know what to expect, the people demanded of those entrusted
with prophecy and knowledge.

The Bible mentions several such records — "books" — that
may have held the answers but that have completely van-
ished. One is the Book of Jashar, the Book of Straightness
if literally translated but probably meaning the record of the
Right Things. The other and probably much more important
was the Book of the Wars of Yahweh, implying by its enig-
matic title that it dealt with wars and conflicts among the
Elohim.

Such conflicts, flaring at times into open warfare, were
recorded in Sumerian writings; and such writings from the
past were truly Divine Words, for the texts were either writ-
ten down by the Divine Scribes or dictated by the gods to
human scribes. Originally recorded by the gods themselves
were the events on Nibiru that involved the seizing of the

Prophecy: Writings from the Past 189

throne there by Anu and the continuation of the struggle for
succession to another planet, Earth; the tale of Zu; the con-
tending between Horus and Seth (which led to the first-ever
enlisting of Mankind in a war between the gods). And in that
category, of writings by the gods themselves, belonged a
"Prophecy Text" that has come to us in the Akkadian ver-
sion and which was nothing short of an autobiography by
Marduk. In the other category, that of books directly dictated
by a deity, was a text known as the Erra Epos, a record of
events as told by Nergal. Both those texts were attempts by
the gods to explain to Mankind how two millennia of civi-
lization — the Olden Days — had come abruptly to an end.

It was more than ironic that the events that had triggered
the end of the great Sumerian civilization coincided with its
most glorious epoch. An "olden book" — a Sumerian text —
recorded the Council of the Great Gods at which the grant
of Kingship (civilization) to Mankind was decided upon:

The great Anunnaki who decree Fates

sat exchanging their counsels regarding the land.

They who created the four regions.

who set up the settlements, who oversaw the land.

were too lofty for Mankind.

And so they decided that the institution of Kingship should
be created, both as a buffer as well as a link between the
Lofty Ones and the mass of humanity. Up to then, the Earth-
lings were allowed to live beside the sacred precincts in the
cities of the Gods; thereafter, they were to have their own
cities, ruled by LU.GALs, "Great Men" — kings — who were
to act as surrogates for the divine lords.

When the Anunnaki returned to the Edin, the plain be-
tween the Tigris and Euphrates after the plain had dried
enough after the Deluge, they reestablished the Cities of the
Gods exactly in accordance with the pre-Diluvial plan. The
first one to be rebuilt was Eridu, Enki's city; and it was there,
we believe, that the momentous decision to grant Mankind

190

THE COSMIC CODE

civilization was made; the time, archaeological evidence
shows, was circa 3800 B.C.

But in compliance with the gods' decision, Kingship of
Men had to begin at a City of Men, and that one was a new
settlement called Kish. The date was marked by the grant of
a calendar to Mankind, a calendar designed at Enlil's "cult
center," Nippur. It began to tick in 3760 B.C.

The Sumerian King List recorded the recurring transfer of
the land's capital city from one City of Men to another in
Sumer. Such shifts were not unrelated to the fortunes and
shifts of authority between the gods themselves, or even the
rivalries between them — both in the First Region (Mesopo-
tamia and neighboring lands), the Second Region (the Nile
Valley) and the Third Region (the Indus Valley) (where civ-
ilizations followed circa 3100 B.C. and 2900 B.C.). Rumbling
below the surface and from time to time violently erupting
was the conflict between Marduk and Ninurta — the heirs ap-
parent of Enki and Enlil respectively, who took over as their
own the erstwhile rivalry between their fathers. There was

Prophecy: Writings from the Past 191

indeed no Peace on Earth until Marduk — having caused the
death of Dumuzi — had his sentence to be buried alive inside
the sealed Great Pyramid commuted to exile. It was the same
punishment — banishment to a distant land — that Marduk had
imposed on his half brother Ningishzidda/Thoth, who had
gone across the oceans to become the Plumed Serpent god
(Quetzalcoatl) of Mesoamerica.

It was during that relative period of peace that began with
the start of the third millennium B.C. that the Sumerian civ-
ilization expanded to neighboring lands and flourished under
great kings, such as Gilgamesh. Within a few centuries, the
northward expansion incorporated Semitic tribes; and circa
2400 B.C. a greater dominion under a Righteous King
(Sharru-kin) — Sargon I — was formed with a capital in the
new city of Agade. It was henceforth known as the unified
kingdom of Sumer and Akkad.

Numerous texts, mostly fragmented, have been found that
record the course of events — the affairs of both gods and
men — in the ensuing centuries. The empire's center kept
changing. Finally, in 2113 B.C.. the most glorious chapter in
the history of Sumer and Akkad began. Historians refer to
the era as the Ur III period, for it was the third time that Ur
had become the empire's capital. It was the "cult center" of
Nannar/Sin. who resided in its sacred precinct (Fig. 65) with
his spouse Ningal. Their lordship was enlightened and be-
nevolent. The king they had anointed to start the new dy-
nasty, Ur-Nammu ("The Joy of Ur") was wise, righteous,
and a master of international trade in which Sumer ex-
changed grains and woolen products for metals and timbers;
its colorful coats were prized, according to the Bible, even
in distant Jericho. The "merchants of Ur" were internation-
ally known and respected; through them Sumerian civiliza-
tion, in all of its aspects, spread far and wide. In need of
more wool, the Sumerians tapped into the grazing plains in
the northern regions, where a major trading outpost was es-
tablished at the gateway to Asia Minor, the land of the Hit-
tites. It was named Harran — "The Caravanry." Intended to

192

THE COSMIC CODE

Figure 65

serve as a mini-Ur, an Ur-away-from-Ur, it emulated in lay-
out and in its temple Ur itself.

All the while, from his exile, Marduk was watching these
developments with a growing sense of frustration and anger.
In his autobiography (a copy of which was discovered in the
library of Ashurbanipal) Marduk recalled how, after having
wandered in many lands, "from where the sun rises to where
it sets," he had arrived in Hatti Land (the land of the Hit-
tites). "Twenty-four years in its midst I nested," he wrote.
And all during these years he kept asking the council of the
gods: "Until when?"

In the absence of a clear or satisfactory answer. Marduk
looked to me heavens. Fate, we have said, has twelve sta-
tions; the Fate-Station (zodiacal house) of Marduk was the
constellation of the Ram (Aries); and as Precession kept
shifting the first day of spring away from the constellation
of the Bull (Taurus) — Enlil's zodiacal house — it came ever

Prophecy: Writings from the Past 193

closer to "entering" the Fate-Station of Marduk's Ram. Sure
that the time has come for his Destiny to be fulfilled, Marduk
envisioned himself returning to Babylon with pomp and cir-
cumstance, appointing a worthy king, watching the nations
at peace and the peoples prosper — a prophetic vision of what
shall come to pass at the Latter Days when Babylon shall
live up to its name: Bab-ili, "Gateway of the Gods."

Other texts from that time, that scholars consider part of
the collection of Akkadian Prophecies, recorded reports of
astronomers who watched the heavens for planetary omens
connected with the constellation of the Ram. The omens,
however, were mostly ones of warfare, slaughter, plunder,
destruction; and it was those prophecies, rather than Mar-
duk's rosy ones, that have come to pass. The other gods, led
by Ninurta and by Marduk's own brother Nergal, using sci-
entific tools "from the Olden Days," "artifacts of Heaven
and Earth," claimed that the shift to the Age of the Ram had
not yet occurred. Impatient. Marduk sent his son Nabu to
raise a human army from among their followers in the Lands
of the West — the lands west of the Euphrates River. In 2024
B.C. Nabu launched a successful invasion of Mesopotamia
and opened the gates of Babylon to his father Marduk.

The Erra Epos relates those momentous events from the
viewpoint of Nergal (nicknamed Erra. The Annihilator) and
Ninurta (nicknamed Ishum. The Scorcher). It details frantic
negotiations to settle the dispute peacefully, calls on Marduk
to be patient; endless debates at the Council of the Anunnaki
that in the end was meeting in continuous session; alarm at
the true intentions of Nabu and his human army; and finally
suspicions that while Marduk speaks of Babylon as the Gate-
way of the Gods, his son — with followers in the areas bor-
dering on the spaceport in the Sinai — was really intending
to capture the spaceport and thus control contact with the
home planet Nibiru.

Seeing no other way to stop Marduk and Nabu. the Coun-
cil of the Great Gods authorized Nergal and Ninurta to un-
lock the "Seven Awesome Weapons" that had been hidden
under lock and seal in the Abzu (Enki's abode in southeast-

194 THE COSMIC CODE

ern Africa). A nuclear holocaust was unleashed; it vaporized
the spaceport, leaving a huge gash in the peninsula's face
and a vast blackened area all around it. The "sinning cities"
that sided with Nabu in what was then a fertile valley south
of the Dead Sea were likewise obliterated — an upheaval that
Abraham could see from his abode in the south of Canaan.

But as Fate would have it, the nuclear "cloud of death,"
carried by the prevailing Mediterranean winds, drifted east-
ward toward Mesopotamia; in its path, all that was alive —
people, animals, plants — died a horrible death. As the
deathly cloud neared Sumer, the Anunnaki gods began to
abandon their cities. But Nannar/Sin would not accept the
doom of his splendid city Ur. His appeals to Anu and Enlil
to find a way to spare Ur were of no avail; and as the helpless
Enlil bluntly told him, "Ur was granted kingship — an ev-
erlasting reign it was not granted... Its kingship, its reign,
has been cut" — not to everlast was its NAM. TAR, a Destiny
that can be cut and broken, Fate.

But as fate would have it, the winds, as they reached Mes-
opotamia, changed course to the southeast. And while Sumer
and its great olden cities lay prostrate and desolate, the city
of Babylon to the north was completely spared.

Until then Marduk had looked to the heavens to divine his
Fate. The miraculous sparing of Babylon from the nuclear
death and desolation led him to wonder whether his now
unobstructed way to supremacy was more man Fate —
whether it was his Destiny.

Were Marduk not a deity already, one could have said that
what ensued was his deification. In the circumstances, let us
call it his Celestialization. The vehicle for that was an alter-
ation ("falsification" is equally applicable) of the hallowed
text of Enuma elish: to call Nibiru "Marduk" and thereby
make me supreme planetary god and the supreme god on
Earth one and the same. After so substituting "Marduk" for
Nibiru in the tale of the Celestial Battle, the crucial words
were men applied to him: Obtaining a Tablet of Destinies
from Kingu, the chief of Tiamat's host,

Prophecy: Writings from the Past 195

The Tablet of Destinies he look from him.

Sealed it with a seal.

To his [own] breast fastened it.

His was now a Destiny. And the gods, in their Assembly,
to "this utterance paid heed." They bowed and shouted:
"Marduk is king!" Accepting the inevitable, Anu and Enlil
(in the words of an inscription by the Babylonian king Ham-
murabi),

Determined for Marduk, the firstborn of Enki,

the Enlil-functions over all mankind,

Made him great among the gods who watch and see.

Called Babylon by name to be exalted,

made it supreme in the world;

And established for Marduk, in its midst,

an everlasting Lordship.

The coronation — to use an understandable term — of Mar-
duk as "king of the gods" took place in a solemn ceremony,
at an assembly of the Fifty Great Gods and the "Seven Gods
of Destiny," and with hundreds of rank and file Anunnaki
present. Symbolically, Enlil laid before Marduk his divine
weapon, the Bow (which in the heavens had the Bow-star as
its counterpart). Then the transfer of the Enlil-powers to Mar-
duk was further celebrated by the transfer to Marduk of the
secret numerical rank of 50. That was done by a recitation,
one by one, of the "fifty names." They start with Marduk's
proper name, asserting that it was Anu himself who had so
named Marduk when he was bom, and, running through the
rest of the epithet-names, ends with Nibiru — the transfor-
mation of the god on Earth into the supreme planetary god.

The fifty names are made up from Sumerian words or
syllable combinations — epithets of whoever had possessed
the fifty names before the Epic of Creation was falsified to
accommodate Marduk; and although the Babylonian editors
of the text (written in the Akkadian language) attempted to
explain to their contemporaries the enigmatic Sumerian syl-

196 THE COSMIC CODE

labic words, it is evident that even they could not fully grasp
what secret message each name had conveyed. That such
secret meanings or encodings underlay the fifty names was
recognized by the renowned Assyriologist and biblical
scholar E. A. Speiser; rendering Enuma elish in English for
Ancient Near Eastern Texts Relating to the Old Testament,
he observed that "the text etymologizes the names in a man-
ner made familiar by the Bible; the etymologies, which ac-
company virtually every name on the long list, are meant to
be cabalistic and symbolic rather than strictly linguistic."

There is more in the Fifty Names of a "Kabbalistic" na-
ture than the above observation allows. The first nine names
are listed at the end of the sixth tablet of Enuma elish, and
are accompanied by several accolade verses. As had been
noted by Franz M. Th. Bohl in his Die funfzig Namen des
Marduk, the utterance of those first nine names was attributed
to forefathers not only of Marduk but even of Anu himself;
three of them contained triple meanings each; and in one
such meaning-within-meaning, the unique (and otherwise un-
reported) ability to "revive the dead gods" was attributed to
Marduk. That. Franz Bohl suggested, could be a reference to
the death and resurrection of Osiris (of Egyptian lore), be-
cause the ensuing three names (numbers 10, 11, 12) are var-
iants of the epithet-name ASAR (Asaru in Akkadian) and,
according to Bohl, three epithets that paralleled three epithets
of the Egyptian god.

With those three epithet-names Enuma elish moves on to
the seventh tablet — not without implications for the seven
days of Creation in Genesis (of which the first six were per-
iods of activity and the seventh a day of rest and divine
contemplation); and seven was, we will recall, the planetary
designation of Earth and of Enlil as Earth's Commander.

The three ASAR epithets, after which the epithet-names
become varied and diverse, bring the total of names to
twelve. They are additionally explained in four verses giving
the fourfold meaning of the three ASAR names, suggesting
again an attempt to incorporate twelve into the text. The rec-
itation of the fifty names thus incorporates the divine rank

Prophecy: Writings from the Past 197

number of Enlil and his planetary number, the number of the
members of the Solar System, and of the constellations.

"All of my instructions are embodied in the fifty names,"
Enki announced at the conclusion of the ceremony. In those
names, "all the rites have been combined." In his own hand
"he wrote it down, preserved for the future," and ordered
that the writing be lodged in the Esagil temple that the gods
shall build for Marduk in Babylon. There the secret knowl-
edge shall be safeguarded by a line of priestly initiates,
passed from father to son: "Let them be kept [there], let the
elder explain them; let the wise and knowing father impart
to the son."

What deeper meanings, what secret knowledge do the fifty
names hold that, according to Enki, combine in them all mat
mere was to know?

Perhaps one day, when a new discovery will enable us to
decode the numerical encryptions of Assyrian and Babylo-
nian kings, we too will know.

10

NAVEL OF THE EARTH

Twenty-four years before the nuclear calamity two paths
crossed, and not by accident. One was that of a god who
was certain that his Fate had become a Destiny; the other
was of a man whose Destiny became his Fate. The god was
Marduk; the man was Abraham; the place where their paths
crossed was Harran.

And an outcome of that was to last to our very own times,
when Babylon (now Iraq) rained deathly missiles on the land
of Jerusalem (now Israel).

That Abraham had sojourned in Harran is known from the
Bible. That Marduk had wanderings in faraway lands, and
that he ended up in the land of the Hittites, we know from
his autobiography. That the specific place where he had spent
twenty-four years was Harran is surmised by us from the
very opening words of Marduk's "autobiography": He be-
gins his query, "Until when?" by addressing it to ilu Har-
anim, the "gods of Harran" (Fig. 66), as the immediately
present gods, and only then goes on to the distant Great Gods
Who Judge.

Indeed, to be in Harran was a logical choice, for it was a
major urban and religious center — lying at the crossroads of
trade routes — and a hub of communications, at the border of
Sumer and Akkad but not yet within Sumer proper, Harran
was a perfect headquarters for the god whose son was raising
an invasion army.

A sojourn of twenty-four years before the invasion and the
nuclear holocaust that occurred in 2024 B.C. means that Mar-
duk arrived in Harran in 2048 B.C. That, by our calculations

198

Navel of the Earth

199

Figure 66

(based on a careful synchronization of biblical, Mesopota-
mian, and Egyptian data) was on the very footsteps of
Abram/ Abraham. He was born, by our calculations, in 2123
B.C. Every move of Terah and his family, we have shown in
The Wars of Gods and Men, was linked to the fast-
developing events in Ur and the Sumerian empire. The Bible
informs us that Abram/Abraham left Harran, on God's in-
structions, at age 75. The year, then, was 2048 B.C. — the very
year in which Marduk had arrived in Harran! And it was
then that Yahweh — not just "the Lord, God" — "said unto
Abram: Get thee out of thy country, and out of thy birthplace,
and from thy father's dwelling place, unto the land which I
will show thee." It was a triple departure — from Abram's
country (Sumer), and from his birthplace (Nippur), and from
his father's dwelling place (Harran); and it was to a new and
unfamiliar destination, for Yahweh had to show it to Abram.

200 THE COSMIC CODE

Taking his wife Sarai and his nephew Lot with him,
Abram went to "the land of Canaan." Arriving from the
north (crossing over perhaps where his grandson Jacob
would later cross), he moved fast southward, reaching a place
called Alon-Moreh — a name literally meaning "The oak tree
which points," apparently a well-known landmark that a
traveler could not miss. To be certain that he was traveling
correctly. Abram awaited further instructions; and "Yahweh
appeared there unto Abram," confirming that he was in the
right place. Moving on, Abram reached Beth-El ("God's
Abode") and again "called out the name of Yahweh," con-
tinuing thereafter without stopping to the Negev ("The Dry-
ness"), me southernmost part of Canaan bordering on the
Sinai peninsula.

He did not linger there long. Food was short there. So
Abram moved on, all the way to Egypt. It is customary to
depict Abraham as a nomadic Bedouin chieftain, spending
his days tending his flocks or lolling in his tent. In fact he
had to be much more than that, for otherwise why was he
chosen by Yahweh to be sent on the divinely ordained mis-
sion? He was descended from a line of priests; and the names
of his and his brother's wives, Sarai ("princess") and Mil-
cah ("queenly") indicate a connection with Sumer's royal
line. No sooner did Abram reach the Egyptian border than
he coached his wife on how to behave when they would be
received at the Pharaoh's court (and later on, back in Canaan,
he dealt with its kings as an equal). After a sojourn of five
years in Egypt, when Abram was ordered back to the Negev,
he was provided by the Pharaoh with a great number of men
and women to be in his service, and with flocks of sheep
and herds of oxen and she-asses and he-asses — as well as
with a flock of highly prized camels. The inclusion of camels
is significant, for they were suited for military purposes in
desert conditions.

That a military conflict was brewing we learn in the chap-
ter immediately following in Genesis (chapter 14), dealing
with the invasion of southern Canaan by a coalition of Kings
of the East — from Sumer and its protectorates (such as Elam,

Navel of the Earth 201

in the Zagros Mountains, which was renowned for its fight-
ing men). Capturing city after city as they followed the
King's Highway, they detoured around the Dead Sea and
headed straight for the Sinai peninsula (see map p. 26). But
there Abram and his armed men blocked the invaders' way.
Disappointed, the invaders satisfied themselves by looting
the five cities (that included Sodom and Gomorrah) in the
fertile plain south of the Dead Sea; among the prisoners they
took was Lot, Abram's nephew.

When word reached Abram that his nephew had been
taken captive, he pursued the invaders with 318 select men
all the way to Damascus. Since some time had passed until
a refugee from Sodom told Abram about his nephew's cap-
ture, it was quite a feat for Abram to catch up with the in-
vaders, who were already at Dan, in the north of Canaan. It
is our suggestion that the "trained young men" as they are
called in Genesis were camel-riding cavalrymen (Fig. 67),
from a Mesopotamian sculpture.

"It was after those events," the Bible states (Genesis 15),
"that Yahweh spoke to Abram in a vision, saying: Fear not,
Abram; I am thy shielder; thy reward shall be exceedingly
great."

It is time to review the Abram saga up to this point and
to ask some questions. Why was Abram told to forsake
everything and go to a completely strange place? What was
special about Canaan? Why the rush to reach the Negev, on
the border of the Sinai peninsula? Why the royal reception
in Egypt and the return with an army and a camel-cavalry?
What was the target of the invaders from the East? And why
was their defeat at the hands of Abram deserving of a prom-
ise of a "great reward" from God?

Far from the customary picture painted of Abram as a
nomadic sheepherder, he turns out to be a superb military
leader and a major actor on the international scene. It can all
be explained, we suggest, only if one accepts the reality of
the Anunnaki presence and takes into consideration the other
major events occurring at the same time. The only prize
worth an international war — at the very time that Nabu was

202

THE COSMIC CODE

Figure 67

organizing fighters in the lands west of the Euphrates — was
the spaceport in the Sinai. It was that which Abram — allied
with the Hittites and trained by them in martial arts — was
hurriedly sent to protect. It was to that purpose that an Egyp-
tian Pharaoh in Memphis, himself facing an invasion by fol-
lowers of Ra/Marduk based in Thebes in the south, provided
Abram with a camel-riding cavalry and a large number of
other men and women servants. And it was because Abram
successfully protected the gateway to the spaceport that Yah-
weh assured him of a great reward — as well as promised him
protection from future retribution by the losing side.

The War of the Kings took place, by our calculations, in
2041 B.C. The year after that the princes of the south captured
Memphis in Egypt and dethroned Abram's ally, declaring
allegiance to Amon-Ra, the "hidden" or "unseen" Ra/Mar-
duk, who was then still in exile. (After Marduk's rise to

Navel of the Earth 203

Figure 68

supremacy, the new rulers of Egypt began building in Kar-
nak, a suburb of the capital Thebes, Egypt's greatest temple
in honor of Amon-Ra; they lined the majestic avenue leading
to it with ram-headed sphinxes — Fig. 68 — honoring the god
whose age, the Age of the Ram, had arrived).

Things were no less hectic in Sumer and its empire. Ce-
lestial omens, including a total lunar eclipse in 2031 B.C.,
predicted coming doom. Under the pressure of Nabu's war-
riors, the last kings of Sumer drew back their forces and
protective outposts ever closer to the capital Ur. There was
little comfort to be found in appeals to the gods, for the gods
themselves were engulfed in the sharpening confrontation
with Marduk. Gods as well as men looked to the heavens
for signs. A human, even one as qualified or chosen as
Abram, could no longer protect the essential facility of the
Anunnaki, the spaceport. And so, in 2024 B.C., with the con-
sent of the Council of the Great Gods, Nergal and Ninurta
used nuclear weapons to keep the prize from Marduk. It is
all described vividly and in detail in the Erra Epos; it is there
also that a sideshow, the upheaval of the "sinning cities"
that included Sodom and Gomorrah, is recounted.

Abram was forewarned about what was to happen: at his
request, two Angels of the Lord went to Sodom the day
before the nuking of the spaceport and the cities to save Lot
and his family. Asking for time to gather his family, Lot

204 THE COSMIC CODE

prevailed on the two divine beings to postpone the upheaval
until he and his family could reach a safe haven in the moun-
tains. The event was thus not a natural calamity — it was pre-
dictable and postponable.

"And in the morning Abraham got up early and went to
the place where he had stood before Yahweh" the day be-
fore; "and he looked toward Sodom and Gomorrah, and to-
ward all the land of the plain; and he beheld and saw a smoky
steam rising from the earth, as the steamy smoke of a fur-
nace."

On God's orders, Abraham moved away from the place,
getting closer to the seashore. In the mountains in south-
eastern Jordan, Lot and his daughters huddled in fear; their
mother, having lingered behind as they were escaping from
Sodom, was vaporized by the nuclear explosion. (The usual
translation of the words, that she was turned into a pillar of
salt, stems from a misreading of the Sumerian word that
could mean both "salt" and "vapor"). Convinced that they
had just witnessed the end of the world, the two daughters
of Lot decided that the only way to enable the human race
to survive was to have them sleep with their own father. Each
one had a son that way; they were, according to the Bible,
the progenitors of two tribes east of the Jordan River: the
Moabites and the Amonites.

And as for Abraham: "God remembered Sarah as he had
promised" (when He appeared to them with the two Angels
the year before), "and Sarah conceived and bore Abraham a
son in his old age," and they named the son Isaac. Abraham
was 100 years old at the time; Sarah was 90.

With the spaceport gone, Abraham's mission had come to
an end. Now it was up to God to keep His end of the bargain.
He had "cut a covenant" with Abraham to give him and his
descendants as an everlasting legacy the lands between the
Brook of Egypt and the Euphrates River. And now, through
Isaac, the promise had to be kept.

And there was also the question of what to do with the
other space facilities.

Navel of the Earth 205

There were, to be sure, two such facilities in addition to
the spaceport itself. One was the Landing Place, to which
Gilgamesh had set his course. The other was the Mission
Control Center — no longer needed, but still intact; a post-
Diluvial "Navel of the Earth," serving the same function as
the pre-Diluvial "Navel of the Earth" that Nippur had been.

To understand the similar functions and consequently sim-
ilar layouts, one should compare our sketches of the pre- and
post-Diluvial space facilities. Before the Deluge (Fig. 69)
Nippur, designated the "Navel of the Earth" because it was
at the center of concentric circles delineating the Landing
Corridor, served as Mission Control Center. Cities of the
Gods whose names meant "Seeing the Red Light" (Larsa),
"Seeing the Halo at Six" (Lagash) and "Seeing the Bright
Halo" (Laraak) marked out both the equidistant spacing and
the landing path toward Sippar ("Bird City"), the site of the
spaceport. The landing path, within an elongated Landing
Corridor, was based at its point on the twin peaks of Mount
Ararat — the most prominent topographic feature in the Near
East. Where that line intersected the precise line northward,
the spaceport was to be built. Thus, the Landing Path formed
a precise 45° angle with the geographic parallel.

After the Deluge, when humanity was granted the three
Regions, the Anunnaki retained for themselves the Fourth
Region — the Sinai peninsula. There, in the central plain, the
ground was both flat and hard (perfect tank terrain, as mod-
ern armies have concluded), unlike the mud-buried and
water-clogged post-Diluvial plain in Mesopotamia. Choosing
again the twin peaks of Ararat as the anchor point, the An-
unnaki drew a landing path at the same 45° angle to the
geographic parallel — the 30th parallel north (Fig. 70).

There in the central plain of the Sinai peninsula, where
the diagonal line intersected the 30th parallel, was to be the
spaceport. To complete the layout, two more components
were required: To establish a new Mission Control Center,
and to delineate (and anchor) the Landing Corridor.

We believe that the outlining of the Landing Corridor pre-
ceded the choosing of the site for Mission Control Center.

206

THE COSMIC CODE

1. Et14i>

1. Lara*

I. XI prci

4. Bad-Tlblra

5. Larak

6. SIPPa*

T, ShuruppaV

I, Lagaah

The reason? The existence of the Landing Place, in the Cedar
Mountains in Lebanon.

Every folklore, every legend connected with the place re-
peats the same assertion, that the place existed before the
Flood. As soon as the Anunnaki landed back on Earth after
the Deluge on the peaks of Ararat, they had at their disposal
a real, functioning Landing Place — not a full-fledged space-

Navel of the Earth

207

Figure 70

port, but a place to land on. All the Sumerian texts dealing
with the grant to Mankind of "domesticated" (i.e. geneti-
cally altered) plants and animals describe a biogenetic lab-
oratory in the Cedar Mountains, with Enlil now cooperating
with Enki to restore life on Earth. All the modern scientific
evidence corroborates that it was from that particular area

208 THE COSMIC CODE

that wheat and barley and the first domesticated animals had
come. (Here again modern advances in genetics join the pa-
rade of corroborations: A study published in the journal Sci-
ence as recently as November 1997 pinpoints the place where
wild einkorn wheat was genetically manipulated to create the
"Founder Crop" of eight different cereals: some 11,000
years ago, in that particular corner of the Near East!)

There was every reason to include this place — a vast stone
platform of massive construction — in the new space facili-
ties. That, in turn, determined by equidistant concentric cir-
cles the location of Mission Control Center.

To complete the space facilities, it was necessary to anchor
the Landing Corridor. In its southeastern end, two nearby
peaks — one of which remained hallowed to this day as the
so-called Mount Moses — were handy. In the equidistant
northwestern edge mere were no peaks, just a flat plateau.
The Anunnaki — not any mortal Pharaoh — built there two ar-
tificial mountains, the two great pyramids of Giza (the
smaller Third Pyramid, we have suggested in The Stairway
to Heaven, was built first as a test scale model). The layout
was completed with a "mythological" animal carved from
the native rock — the sphinx. It gazes precisely along the 30th
parallel, eastward toward the spaceport in the Sinai.

These were the components of the post-Diluvial space-
port of the Anunnaki in the Sinai peninsula, as built by
them circa 10500 B.C. And when the landing and takeoff
place in the Sinai's central plain was blown up, the space-
port's auxiliary components remained standing: the Giza
pyramids and Sphinx, the Landing Place in the Cedar
Mountains, and Mission Control Center.

The Landing Place, as we know from the adventures of
Gilgamesh, was there circa 2900 B.C. Gilgamesh witnessed
mere, the night before he had attempted entry, a rocketship
rising. The place remained extant after the Deluge — a Phoe-
nician coin depicted vividly what had stood atop the stone
platform (Fig. 71). The vast stone platform still exists. The
place is called Baalbek — for it was the "Secret Place of the
North" of the Canaanite god Ba'al. The Bible knew the place

Navel of the Earth 209

Figure 7 1

as Beth-Shemesh, "House/Abode of Shamash" (the Sun
God) and it was within the domains of King Solomon. The
Greeks after Alexander called the place Heliopolis, meaning
"City of Helios," the Sun God, and built there temples to
Zeus, his sister Aphrodite, and his son Hermes. The Romans
after them erected temples to Jupiter, Venus, and Mercury.
The temple to Jupiter was the largest temple ever buill by
the Romans anywhere in the empire, for they believed that
the place was the most important oracle place in the world,
one that would foretell the fate of Rome and its empire.

The remains of the Roman temples still stand atop the vast
stone platform; so does, undisturbed by the passage of time
and the ravages of nature and men, the platform itself. Its
flat top rests on layer upon layer ("courses") of large stone
blocks, some weighing hundreds of tons. Of great renown
from antiquity is the Trilithon — a group of three colossal
stone blocks, lying side by side and forming a middle course
where the platform had sustained its greatest load-impact
(Fig. 72, with a passing man for size comparison). Each of
these colossal megaliths weighs about 1,100 — one thousand
one hundred — tons; it is a weight that no modern piece of
equipment can even come close to lifting and moving.

But who could have done that in antiquity? The local leg-

210

THE COSMIC CODE

Figure 72

end says: the Giants. They not only placed those stone blocks
where they are, they also quarried and shaped and carried
them over a distance of almost a mile; that is certain, for the
quarry has been found. There, one of the colossal stone
blocks protrudes from the mountainside half-quarried (Fig.
73); a man sitting on it looks like a fly on a block of ice.

Down at the southern end of the Landing Corridor, the
Giza pyramids still stand, defying all traditional explanations,
challenging Egyptologists to accept that they had been built
millennia before the Pharaohs and not by any one of them.
The sphinx still gazes precisely eastward along the 30th par-

Navel of the Earth 211

Figure 73

allel, keeping to itself its secrets — perhaps even the secrets
oftheBookofThoth.

And what about Mission Control Center?

That, too, exists; it is a place called Jerusalem.

And there, too, a great and sacred platform rests atop
colossal stone blocks that no man or ancient machine
could have moved, raised, and put in place.

The biblical record of Abraham's comings and goings in
Canaan includes two instances of seemingly unnecessary di-
gression; in both instances, the place digressed to was the
site of the future Jerusalem.

The first time me digression is reported as an epilogue to
the story of the War of the Kings. Having caught up with
and defeated the invaders all the way north near Damascus,
Abraham returned to Canaan with the captives and the booty;

And the king of Sodom went forth toward him —
after he was returning from smiling Khedorlaomer
and the kings who were with him —
to the Valley of Shaveh, which is the king's valley.

And Melchizedek, the king of Shalem —

and he was a priest unto the God Most High —

2 1 2 THE COSMIC CODE

brought forth bread and wine,
and he blessed him, saying:

"Blessed be Abram unto God Most High.

Creator of Heaven and Earth;

And blessed be the God Most High,

who hath delivered thy enemies unto thy hands."

Melchizedek (whose name has meant in Hebrew exactly
what the Akkadian Sharru-kin, "Righteous King," has
meant) offered Abram to keep a tenth of all of the booty that
he had retrieved. The king of Sodom was more generous:
Keep all the wealth, he said, just return to me the captives.
But Abram would have none of that; swearing by '"Yahweh,
the God Most High, Creator of Heaven and Earth," he said
he would not keep even a shoelace (Genesis chapter 14).

(Scholars have long debated, and will undoubtedly con-
tinue to debate, whether Abraham swore by the "God Most
High" of Melchizedek, or meant to say: No, Yahweh is the
God Most High by whom I will swear.)

This is the first time that an allusion is made in the Bible
to Jerusalem, here called Shalem. That this was a reference
to what was later known as Jerusalem is based not only on
long-standing traditions, but also on the clear identification
in Psalm 76:3. It is generally accepted that the full name.
Yeru-Shalem in Hebrew, meant "The city of Shalem,"
Shalem being a deity's name. Some suggest, however, that
the name could also mean "Founded by Shalem." And it
could also be argued that the word Shalem was not a name
or even a noun, but an adjective, meaning "complete,"
"without defect." That would make the place's name mean
"the Perfect Place." Or, if Shalem be a deity's name, it
could mean the place of the "One who is perfect."

Whether honoring a god, established by a god, or the Per-
fect Place, Shalem/Jerusalem was located in the most un-
likely place as far as Cities of Man were concerned. It was
located amidst barren mountains, neither at any trade or mil-
itary crossroads, nor near any food or water sources. Indeed,

Navel of the Earth 213

it was a place almost completely bereft of water, and the
proper supply of drinking water was constantly to be a prin-
cipal problem and vulnerability of Jerusalem. Shalem/Jeru-
salem featured neither in Abraham's migrations nor in the
route of the invasion from the east, nor in his pursuit of the
invaders. Why then a detour for a victory celebration — a de-
tour, one is inclined to say, to a "godforsaken place" — ex-
cept that the place was definitely not God-forsaken. It was a
place — the only place in Canaan — where a priest serving the
God Most High was located. And the question is, Why there?
What was special about the place?

The second seemingly unnecessary digression had to do
with the testing by God of Abraham's devotion. Abram had
already carried out his mission to Canaan. God had already
promised him that his reward would be great, that God him-
self should protect him. The miracle of a son and Legal Heir
at extreme old age had happened; Abram's name was
changed to Abraham, "Father of a multitude of nations."
The land was promised to him and his descendants; the
promise was incorporated in a covenant that involved a mag-
ical ritual. Sodom and Gomorrah had been destroyed and all
was ready to let Abraham and his son enjoy the peace and
quiet to which they were surely entitled.

Then, all of a sudden, "it was after all those things," the
Bible says (Genesis chapter 22), "that God tested Abra-
ham," telling him to go to a certain place and there sacrifice
his own beloved son:

Take now thou thy son Isaac,

thy only one whom thy lovest,

and get thee unto the Land of Moriah;

and offer him there as a sacrifice

on one of the mounts

which I shall point out to thee.

Why God decided to test Abraham in that excruciating
way, the Bible does not explain. Abraham, ready to carry out
the divine order, found out in the nick of time that il was

214 THE COSMIC CODE

only a test of his devotion: An Angel of the Lord pointed
out to him a ram caught in the bushes, and told him that it
was the ram that was to be sacrificed, not Isaac. But why
was the test, if it was needed at all, not conducted just where
Abraham and Isaac dwelt, near Beersheba? Why the need to
undertake a journey of three days? Why go to the part of
Canaan mat God identified as the Land of Moriah, and there
to locate a specific mount — which God himself pointed out —
to conduct there the test?

As in the first instance, there had to be something special
about the chosen place. We read (Genesis 22:4) that, "On
the third day Abraham lifted his eyes and saw the place from
a distance." The area was rich, if with anything, with barren
mounts; from nearby, and certainly from a distance, they all
look alike. Yet Abraham recognized the particular mount
"from a distance." There had to be something there that
distinguished it from all me other mounts. So much so that
when the ordeal was over he gave the place a long-
remembered name: The Mount Where Yahweh Is Seen. As
2 Chronicles 3:1 makes clear, Mount Moriah was the Jeru-
salem peak on which the Temple was eventually built.

From the time Jerusalem became a city, it encompassed
three mounts. Listed from the northeast to the southwest,
they have been Mount Zophim ("Mount of Observers,"
now called Mount Scopus in English), Mount Moriah
("Mount of Directing, of Pointing Out") in the center, and
Mount Zion ("Mount of the Signal"); these are designa-
tions of functions that bring to mind the function-names of
the Beacon Cities of the Anunnaki marking out Nippur and
the Landing Path when the spaceport had been in Mesopo-
tamia.

Jewish legends relate that Abraham recognized Mount
Moriah from a distance because he saw upon it "a pillar of
fire reaching from the Earth to Heaven, and a heavy cloud
in which the Glory of God was visible." This language is
almost identical to the biblical description of the presence of
the Lord upon Mount Sinai during the Exodus. But putting

Navel of the Earth 215

such lore aside, what we believe Abraham saw that identified
the mount as different, that distinguished it from all others
there, was the great platform upon it.

A platform which, though smaller than at Baalbek's
Landing Place, was also part of the space facilities of the
Anunnaki. For Jerusalem (before it became Jerusalem),
we suggest, was the post-Diluvial Mission Control Center.

And, as at Baalbek, that platform, too, still exists.

The reason (for the first) and purpose (of the second) di-
gressions thus come into focus. The fulfillment of his mission
was marked by a formal celebration, including a priestly
blessing of Abraham with the ceremonial bread and wine, at
a site — the only site in Canaan — directly connected to the
presence of the Elohim. The second diversion was meant to
test Abraham's qualifications for a chosen status after the
destruction of the spaceport and the resulting dismantling of
the accoutrements of Mission Control Center; and to renew
there the covenant in the presence of Abraham's successor.
Isaac. Such a renewal of the divine vow indeed followed
right away after the test:

And the Angel of Yahweh

called out to Abraham for a second time

from the skies, saying, this is Yahweh's word:

"This is my oath:

Because thou hast done this thing,

and hast not withheld thy son, the unique one,

I will greatly bless thee

and I will exceedingly multiply thy seed...

And in thy seed shall the nations of the Earth

be blessed.

By renewing the divine vow at this particular site, the site
itself — hallowed ground ever since — became part and parcel
of the heritage of Abraham the Hebrew and his descendants.

The Divine Promise to Abraham, he had already been told

2 1 6 THE COSMIC CODE

by God, was to come true only after a passage of time and
a servitude in a foreign land for four hundred years. All told
it was a thousand years later when the descendants of Abra-
ham took possession of the sacred mount, Mount Moriah.
When the Israelites arrived in Canaan after the Exodus, they
found mat a tribe of Jebusites had settled south of the sacred
mount, and let them be, for the time to take possession of
that most hallowed ground had not yet come. The singular
prize went to King David, who circa 1000 B.C. — a thousand
years after me testing of Abraham — captured the Jebusite
settlement and moved the capital from Hebron to what has
been called in the Bible the City of David.

It is important to realize that the Jebusite settlement mat
David captured, and his new capital, were not at all "Jeru-
salem" as it is now envisioned, not even the walled "Old
City." The area captured by David and thereafter known as
the City of David was on Mount Zion, not Mount Moriah.
Even when David's successor Solomon extended the city
northward to a section called Ophel (Fig. 74), it still stopped
short of encroaching on the unique area to the north. It in-
dicates, we suggest, that the sacred platform extending from
there northward on Mount Moriah already existed at the time
of David and Solomon.

The Jebusite settlement was thus not on Mount Moriah
and its platform, but well to its south. (Human dwellings
near — but not within — a sacred precinct were common in
Mesopotamian "cult centers," such as at Ur (see Fig. 65) or
even in Enid's Nippur, as evidenced by an actual map of
Nippur discovered drawn on a clay tablets, Fig. 75).

One of David's first actions was to transfer the Ark of the
Covenant from its latest temporary location to the capital, in
preparation for placing it in a proper House of Yahweh
which David planned to erect. But that honor, he was told
by the Prophet Nathan, was not to be his on account of all
the blood that his hands had shed during the national wars
and his personal conflicts; the honor, he was told, would go
to his son Solomon. All he was allowed to do in the mean-
time was to erect an altar; the precise place for it was shown

Navel of the Earth

217

X . -.. * J.

'-v ^

PtESEHT-MT
"OLD CUT'

Mount
Mor«h

! f °»*«< J i

;■'/*

'til

Figure 74

to David by an "Angel of Yahweh, standing between
Heaven and Earth," pointing out the place with a drawn
sword. He was also shown a Tavnit — a scale model — of the
future temple and given detailed architectural instructions,
which, when the time came, he handed over to Solomon in
a public ceremony, saying:

All of this, in writing by His hand,
did Yahweh make me
understand —
all of the workings of the Tavnit.

218

THE COSMIC CODE

Figure 75

(The extent of those detailed specifications for the temple
and its various sections and the ritual utensils can be judged
from 1 Chronicles 28:11-19).

In the fourth year of his reign — 480 years after the start
of the Exodus, the Bible states — Solomon began the con-
struction of the Temple, "on Mount Moriah, as had been
shown to his father David." While timbers cut from the Ce-
dars of Lebanon and the purest gold of Ophir were imported
and copper for the specified washbasins was mined and
smelted in the famed King Solomon's Mines, the structure
itself had to be erected with "hewn and cut stones, large and
costly stones."

The stone ashlars had to be prepared and cut to size and
shape elsewhere, for the construction was subject to a strict
prohibition against the use of any iron tools for the Temple.
The stone blocks had to be transported, brought over to the
site for assembly only. "And the House, when it was in
building, was built of stone made ready before it was brought
thither; so that mere was neither hammer nor axe nor any
tool of iron heard in the House while it was in building" (1
Kings 6:7).

Navel of the Earth 219

It took seven years to complete the building of the Temple
and to equip it with all the ritual utensils. Then, on the next
New Year ("in the seventh month") celebration, the king
and the priests and all the people witnessed the transfer of
the Ark of the Covenant to its permanent place, in the Tem-
ple's Holy of Holies. "There was nothing in the Ark except
the two stone tablets that Moses had placed therein" at
Mount Sinai. No sooner was the Ark in place under the
winged Cherubim, than "a cloud filled the House of Yah-
weh," forcing the priests to rush out. Then Solomon, stand-
ing at the altar mat was in the courtyard, prayed to God
"who in heaven dwells" to come and reside in his House.
It was later, at night, that Yahweh appeared to Solomon in
a dream and promised him a divine presence: "My eyes and
my heart will be in it forever."

The Temple was divided into three parts, entered through
a large gateway flanked by two specially designed pillars
(Fig. 76). The front part was called the Ulam ("Hallway");
the largest, middle part was the Ekhal, a Hebrew term stem-
ming from the Sumerian E.GAL ("Great Abode"). Screened
off from mat was the innermost part, the Holy of Holies. It
was called the Dvir — literally: The Speaker — for it held the
Ark of the Covenant with the two Cherubim upon it (Fig.
77), from between which God had spoken to Moses during
the Exodus. The great altar and the washbasins were in me
courtyard, not inside the Temple.

Biblical data and references, age-old traditions and ar-
chaeological evidence have left no doubt that the Temple that
Solomon built (the First Temple) stood upon the great stone
platform that still crowns Mount Moriah (also known as the
Holy Mount, Mount of the Lord, or the Temple Mount).
Given the dimensions of the Temple and the size of the plat-
form, there is general agreement where the Temple stood
(Fig. 78), and that the Ark of the Covenant within the Holy
of Holies was emplaced upon a rock outcropping, a Sacred
Rock, which according to unwavering traditions was the rock
upon which Abraham was about to sacrifice Isaac. The rock
has been called in Jewish scriptures Even Sheti'yah — "Foun-

220 THE COSMIC CODE

EAST
Figure 76

dation Stone" — for it was from that stone that "the whole
world was woven." The Prophet Ezekiel (38:12) identified
it as the Navel of the Earth. The tradition was so entrenched
that Christian artists in the Middle Ages depicted the place
as the Navel of the Earth (Fig. 79a) and continued to do so
even after the discovery of America (Fig. 79b).

The Temple that Solomon built (the First Temple) was
destroyed by the Babylonian king Nebuchadnezzar in 576
B.C., and was rebuilt by Jewish exiles returning from Baby-
lon 70 years later. That rebuilt Temple, known as the Second
Temple, was later substantially enhanced and aggrandized by
the Judean king Herod, during his reign from 36 to 4 B.C.
But the Second Temple, in all its phases, adhered to the
original layout, location, and the situating of the Holy of
Holies upon me Sacred Rock. And when the Moslems cap-
tured Jerusalem in the seventh century A.D., they claimed that
it was from that Sacred Rock that Mohammed ascended

Navel of the Earth

221

TI:*T;T:T r t n rt

SB

Figure 77

heavenward for a nighttime visit: and they enshrined the
place by building the Dome of me Rock (Fig. 80) to shelter
and magnify it.

Geologically me rock is an outcropping of the underlying
natural rock, protruding above the level of the stone platform
some five or six feet (the face is not even). But it is a most
unusual "outcropping," in more man one way. Its visible
face has been cut and shaped, with an impressive degree of
precision (Fig. 81a), to form rectangular, elongated, horizon-
tal and vertical receptacles and niches of varying depths and
sizes. These artificial niches and receptacles had to have
some purpose known to whoever had made those incisions
in the rock. What has been only surmised since long ago
(e.g. Hugo Gressmann, Altorientalische Bilder zum Alten
Testament) has been confirmed by recent researchers (such
as Leen Ritmeyer, Locating the Original Temple Mount): the
Ark of the Covenant and the walls of the Holy of Holies had
been emplaced where the long straight cut and other niches
in the face of me rock were made.

The implication of those findings is that me cuts and
niches in the face of the rock date back at least to the time
of the First Temple. There is, however, no mention what-
soever in the relevant passages in the Bible of any such
cutting by Solomon; indeed, it would have been impossible —

222

THE COSMIC CODE

-C

"W

"""'l ™<«^ Italm

Oven** *t
>'•■«■ *■

J

Figure 78

because of the strict prohibition against the use of metal axes
and other tools on the Mount!

The enigma of the Sacred Rock and what had stood on
top of it is magnified by the mystery of what might have
stood under it. For the rock is not a simple outcropping.
It is hollow!

In fact, given permission, one can descend a flight of stairs
built by the Moslem authorities, and end up in a cavelike
cavern the rocky roof of which is the protruding upper part
of me Sacred Rock. This cavern — whether natural or not is
uncertain — also features deep niches and receptacles, both in
the rocky walls and (as could be seen before the floor was
covered with prayer rugs) also in the floor. At one place there

Navel of the Earth

Figures 79a and 79b

is what looks like an opening into a dark tunnel; but what it
is and where it leads is a well-kept Moslem secret.

Nineteenth-century travelers have stated that this cavern is
not the last subsurface cavity associated with the Sacred
Rock; they stated that there is yet another, lower cavity be-
neath it (Fig. 81b). Israeli researchers, fanatically barred from
the area, have determined with the aid of soil-penetrating
radar and sonar technology that there is indeed another major
cavity under the Sacred Rock.

These mysterious cavities have given rise to speculation
not only regarding possible Temple treasures, or Temple rec-
ords mat might have been hidden mere when the First Tern-

224

THE COSMIC CODE

Figure 80

pie and then the Second Temple were about to be overrun
and destroyed. There is even speculation that the Ark of the
Covenant, which the Bible ceased to mention after the Egyp-
tian Pharaoh Sheshak ransacked (but did not destroy) the
Temple circa 950 B.C., might have been hidden there. That,
for the time being, must remain just speculation.

What is certain, though, is that the biblical Prophets and
me Psalmist referred to this Sacred Rock when they had used
the term "Rock of Israel" as a euphemism for "Yahweh."
And the Prophet Isaiah (30:29), speaking of the future time
of universal redemption on the Day of the Lord, prophesied
that the nations of the Earth shall come to Jerusalem to praise
the Lord "on the Mount of Yawheh, at the Rock of Israel."

The Temple Mount is covered by a horizontal stone plat-
form, slightly off-perfect rectangular in shape (because of the
contours of the terrain), whose size is about 1,600 by 900

Navel of the Earth

225

Figures 81a and 81b

feet, for a total stone-paved area of close to 1.500.000 square
feet. Although it is believed that the present-day platform
includes sections, at the extreme south and possibly also in
the north, that had been added between the First Temple's
building and the destruction of the Second Temple, it is cer-
tain that the bulk of the platform is original; it is certainly
so regarding the slightly raised portion, where the Sacred
Rock (and thus the Dome of the Rock) are located.

226 THE COSMIC CODE

As the visible sides of the platforms retaining walls show,
and as more recent excavations have revealed, the natural
bedrock of Mount Moriah slopes considerably from north to
south. Though no one can say with any certainly what the
size of the platform had been in the time of Solomon, nor
estimate precisely the depth of the slopes that had to be filled,
an arbitrary assumption of a platform measuring only
1 ,000,000 square feet and an average depth of 60 feel (much
less in the north, much more in the south), the result is a
landfill requiring 60,000,000 cubic feet of aggregate (soil,
fieldstones). This is a very major construction undertaking.

Yet nowhere in the Bible is there even a mention or a him
of such an undertaking. The instructions for the First Temple
cover pages upon pages in the Bible; every small detail is
given, measurements are precise to an amazing degree, where
this or that utensil or artifact should be is prescribed, how
long the poles that carry the Ark is specified, and so on and
on. But it all applies to the House of Yahweh. Not a word
about the platform on which it was to stand; and that could
only mean that the platform has already been there; there
was no need to construct it.

Standing out in complete contrast to that absence of men-
tion are the repeated references in 2 Samuel and 1 Kings to
the Millo, literally "the filling" — a project begun by David
and enlarged by Solomon to fill up part of the slopes on the
southeastern comer of the sacred platform, so as to enable the
City of David to expand northward, closer to the ancient
platform. Clearly, the two kings were quite proud of that
achievement and made sure it was recorded in the royal
chronicles. (Recent excavations in that area indicate, how-
ever, that what was done was to raise the sloping level by
constructing a series of terraces that grew smaller as they
rose; that was much easier than first surrounding the ex-
panded area with high retaining walls and filling up the gap
with aggregate).

This contrast undoubtedly corroborates the conclusion that
neither David nor Solomon built the vast platform on Mount
Moriah, with the immense retaining walls and enormous

Navel of the Earth 227

amount of landfill required. All the evidence suggests that
the platform already existed when the construction of a Tem-
ple was even contemplated.

Who then built the platform, with all the earthworks and
stonework that it entailed? Our answer, of course, is: the
same master builders who had built the platform at Baalbek
(and, for that matter, the vast and precisely positioned plat-
form on which the Great Pyramid of Giza stands).

The great platform that covers the Temple Mount is sur-
rounded by walls that serve both as retaining walls and as
fortifications. The Bible reports that Solomon built such
walls, as did Judean kings after him. Visible sections of the
walls, especially on the southern and eastern sides, display
constructions from various later periods. Invariably, the
lower (and thus more ancient) courses are built of larger and
better-shaped stone blocks. Of these walls, only the Western
Wall, by tradition and as confirmed by archaeology, has re-
mained hallowed as an actual remnant from the time of the
First Temple — at least in its lowest courses where ashlars
(perfectly cut and shaped stone blocks) are the largest. For
almost two millennia, since the destruction of the Second
Temple, Jews held on to this remnant, worshiping there,
praying to God, seeking personal succor by inserting slips of
paper with a request to God between the ashlars, bewailing
the Temple's destruction and the Jewish people's disper-
sion — so much so that, in time, the Crusaders and other con-
querors of Jerusalem nicknamed the Western Wall the
"Wailing Wall."

Until the reunification of Jerusalem by Israel in 1967, the
Western Wall was no more than a sliver of a wall, about a
hundred feet or so squeezed between residential houses. In
front was left a narrow space for the prayers, and on both
sides, rising house atop house, it encroached on the Holy
Mount. When the houses were removed, a large plaza was
formed in front of the Western Wall and its extension all the
way to its southern corner was unveiled (Fig. 82). And, for
the first lime in almost two millennia, it was realized that the
retaining walls extend downward nearly as much as they had

228

THE COSMIC CODE

Figure 82

been exposed above what has been considered ground level.
As suggested by the hitherto visible portion of the "Wailing
Wall," the lower courses were larger, better shaped, and of
course much older.

Beckoning with mystery and with a promise of ancient
secrets was the extension of the Western Wall to the
north.

There Captain Charles Wilson explored in the 1860s an
archway (which still bears his name) that led northward to a

Navel of the Earth 229

tunnel-like passage and westward to a series of arched cham-
bers and vaults. The removal of the encroaching dwellings
revealed that the current street level lay atop several lower,
now-subterranean, levels of ancient structures that included
more passages and archways. How far down and how far
north did all that extend? That was a puzzle that Israeli ar-
chaeologists finally began to tackle.

In the end what they discovered was mind-boggling.

Using data from the Bible, from the Book of Maccabees
and from the writings of the Jewish-Roman historian Jose-
phus (and taking into account even a medieval legend that
King David knew of a way to ascend the Mount from the
west), Israeli archaeologists concluded that Wilson's Arch
was the entranceway to what must have been in earlier times
an open-air street that ran along the Western Wall, and that
the Wall itself extended northward by hundreds of feet. The
laborious clearing of the rubble, confirming those assump-
tions, led to the opening in 1996 of the "Archaeological
Tunnel" (an event that made headlines for more than one
reason).

Extending for about 1,600 feet from its start at Wilson's
Arch to its exit on Via Dolorosa (where Jesus walked carry-
ing the cross), the Western Wall Tunnel uncovered and
passes through remains of streets, water tunnels, water pools,
archways, structures, and marketplaces from Byzantine, Ro-
man, Herodian, Hasmonean, and biblical times. The thrilling
and eerie experience of walking through the tunnel, deep
below ground level, is akin to being transported in a time
machine — backward into the past with every step.

All along the visitor can see — and touch — me actual parts
of the western retaining wall from the earliest times. Courses
mat have been hidden for millennia have been exposed. In
the northernmost section of the tunnel, the natural bedrock
that slopes upward comes into view. But the greatest sur-
prise, for the visitor as well as for the archaeologists, lies in
the more southerly section of the uncovered wall:

There — at the ancient street level but not yet the lowest
bottom course — there had been emplaced massive stone

230

THE COSMIC CODE

Figure 83

blocks and on top of them four colossal blocks each
weighing hundreds of tons!

In that portion of the Western Wall, a 120-foot section is
made up of stone blocks mat are an extraordinary 11 feet
high, about double even the unusually large blocks that form
the course below. Only 4 stone blocks make up the section;
one of them is a colossal 42 feet long (Fig. 83); another is
40 feet long, and a third over 25 feet long. Soil-penetrating
radar and other soundings have indicated that the depths of
these stones is 14 feet. The largest of the three is thus a stone
mass of about 6,500 cubic feet, weighing 1,200,000 pounds,
which is about 600 tons! The somewhat smaller one weighs
about 570 tons, and the third one about 355 tons.

These are colossal sizes and weights by any yardstick;
the blocks used in the construction of the Great Pyramid
in Giza average 2.5 tons each, with the largest weighing
about 15 tons. Indeed, the only comparison that comes to
mind are the three Trilithons in the great stone platform
of Baalbek, that also form a course above somewhat
smaller but still-colossal stone blocks (see Fig. 72).

Navel of the Earth 231

Who could have emplaced such colossal stone blocks, and
what for?

Because the stone blocks are indented at their margins,
archaeologists assume mat they are from the time of the Sec-
ond Temple (or more specifically the Herodian period, first
century B.C.)- But even those who hold mat the original stone
platform was smaller than the present one agree mat the cen-
tral portion mat encompasses the Sacred Stone, and to which
the massive retaining wall belongs, had existed from the lime
of the First Temple. At that time the prohibition against using
iron tools (that dates back to the time of Joshua) was strictly
enforced. All the stone blocks used by Solomon, without
exception, were quarried, cut, shaped, and prepared else-
where, to be brought to me site only for assembly. That this
was the case regarding the colossal stone blocks under dis-
cussion is additionally clear from the fact mat they are not
part of the native rock; they lie well above it, and have a
somewhat different hue. (In fact, the latest discoveries west
of Jerusalem suggest mat they might have come from a
quarry there). How they were transported and raised to the
required level and then pushed into the necessary emplace-
ment remain questions mat archaeologists are unable to re-
solve.

An answer, however, to me question what for? has been
offered. The site's chief archaeologist, Dan Bahat, writing in
Biblical Archaeology Review, stated: "We believe that on
me other (eastern) face of the western wall at this point,
under the Temple Mount, is an enormous hall; our theory is
that me Master Course" (as this section had come to be
called) "was installed to support and serve as a counter-force
to the vault inside."

The section with the enormous stone blocks lies only
slightly to the south of the location of the Sacred Stone.
To suggest, as we do, that this massive section was needed
for heavy impacts associated with the site's function as a
Mission Control Center with its equipment installed on
and within the Sacred Rock, seems to be the only plau-
sible explanation after all.

11

A TIME OF PROPHECY

Was the delay in the start of building the Jerusalem Temple
due to the reason given — David's shedding of enemy blood
in wars and feuds — or was that just an excuse, obscuring
another more profound reason?

One finds it odd that as a result of the delay the span of
time that had passed from me renewed covenant with Abra-
ham (and on that occasion also with Isaac) on Mount Moriah
until the Temple's building began was exactly a thousand
years. It is odd because the exile of Marduk had also lasted
a thousand years; and that seems to be more than a chance
coincidence.

The Bible makes it clear that the timing of the Temple's
building was determined by God himself; though the archi-
tectural details and even a scale model were ready, it was
He who said, through the Prophet Nathan: Not yet, not Da-
vid, but the next king, Solomon. Likewise, it is evident that
it was not Marduk himself who had set the time for ending
his exile. Indeed, almost in desperation he cried out: Until
When? And that had to mean that the end of his days of
exile was unknown to him; it was determined by what might
be called Fate — or, if deliberate, by the unseen hand of the
Lord of Lords, the God whom the Hebrews called Yahweh.

The notion that a millennium — a thousand years — signi-
fies more than a calendrical event, portending apocalyptic-
events, is commonly held to have stemmed from a visionary
account in the Book of Revelation chapter 20, in which it
was prophesied that the "Dragon, that old Serpent, which is
the Devil and Satan," shall be bound for a thousand years,

232

A Time of Prophecy 233

cast into a pit and shut therein for a thousand years, unable
to deceive the nations "till the thousand years should be
fulfilled." It will be then that Gog and Magog shall be en-
gaged in a world war; the First Resurrection of the dead shall
occur, and Messianic Times will begin.

Those visionary words, introducing in Christianity the no-
tion (and expectation) of an apocalyptic millennium, were
written in the first century A.D. So, although the book names
Babylon as the "evil empire," scholars and theologians as-
sume that this was a code name for Rome.

But even so, it is significant that the words in Revelation
echo the words of the Prophet Ezekiel (sixth century B.C.)
who had a vision of the resurrection of the dead on the Day
of the Lord (chapter 37) and the world war of Gog and Ma-
gog (chapters 38, 39); it shall take place, Ezekiel stated, "at
the End of Years." It was all, he said, foretold by the Proph-
ets of Yahweh in the Olden Days, "who had then prophesied
about the Years."

"The Years" to be fulfilled, the count till the "End of
Years." It was indeed many centuries before Ezekiel's time
that the Bible offered a clue:

A thousand years,

in thy eyes,

are but as one day that has passed.

The statement, in Psalm 90:4, is attributed in the Bible to
Moses himself; the application of a thousand years to a di-
vine time measurement thus goes back to at least the time of
the Exodus. Indeed, Deuteronomy (7:9) assigns to the dura-
tion of God's Covenant with Israel a period of "a thousand
generations;" and in a Psalm of David composed when the
Ark of the Covenant was brought over to the City of David,
the duration of a thousand generations was recalled once
more (I Chronicles 16:15). Other Psalms repeatedly applied
the number "thousand" to Yahweh and his wonders: Psalm
68:18 even gave a thousand years as the duration of the Char-
iot of the Elohim.

234 THE COSMIC CODE

The Hebrew word for "thousand," Eleph, is spelled with
the three letters Aleph ("A"), Lamed ("L") and Peh ("P"
or Ph"), which can be read as Aleph, meaning the first letter
of the alphabet, and numerically "1." Added together the
three letters have the numerical value 111 (1+30+80),
which can be taken as a triple affirmation of the Oneness of
Yahweh and of monotheism, "One" being a code word for
"God." Not by chance, the same three letters rearranged (P-
L-A) spell Peleh — a wonder of wonders, an epithet for God's
handiwork, and the mysteries of Heaven and Earth that are
beyond human understanding. Those wonders of wonders re-
ferred principally to the things created and foretold in the
long-ago past; they were also the subject of Daniel's inquiry
when he sought to divine the End of Time (12:6).

There thus appear to be wheels within wheels, meanings
within meanings, codes within codes in those verses con-
cerning a millennial period: not just the obvious numerical
sequential count of passing time, but also a built-in duration
of the Covenant, a coded affirmation of monotheism, and a
prophecy concerning the millennium and the End of Years.

And, as the Bible makes clear, the thousand years whose
count began with the building of the Temple — coinciding
with what is now called the last millennium B.C. — was a time
of prophecy.

To understand the events and prophecies of that last mil-
lennium, one ought to turn the clock back to the preceding
millennium, to the nuclear calamity and the assumption of
supremacy by Marduk.

The Lamentation Texts describing the havoc and desola-
tion that engulfed Sumer and Akkad as the deathly nuclear
cloud wafted toward Mesopotamia vividly describe how the
Sumerian gods hurriedly abandoned their "cult centers" as
the Evil Wind advanced toward them. Some "hid in the
mountains," some "escaped to the distant plains." Inanna.
leaving her possessions behind, sailed off to Africa in a sub-
mersible ship: Enki's spouse Ninki. "flying as a bird," went
to the Abzu in Africa while he sought safe haven in the

A Time of Prophecy 235

north; Enlil and Ninlil left to an unknown destination, as did
the spinster Ninharsag. In Lagash the goddess Bau found
herself alone, for Ninurta had been gone since the nuclear
blasting; she "wept bitterly for her temple" and lingered on;
the result was tragic, for "on that day the storm caught up
with her; Bau, as if she were mortal, the storm caught up
with her. "

The list of fleeing gods goes on and on, until it gets to Ur
and its deities. There, as we have already mentioned, Nannar/
Sin refused to believe that his city's fate was sealed. In the
lamentation she herself wrote later, his spouse Ningal de-
scribed how, in spite of the foul smell of the dead whose
bodies filled the city they stayed on "and did not flee." Nor
did they flee on the night that followed me awesome day.
But by morning the two deities, huddled in their ziggurat's
subterranean chamber, realized that the city was doomed, and
they, too, left.

The nuclear cloud, shifted southward by the winds, spared
Babylon; and that was taken as an omen reinforcing the grant
of the fifty names to Marduk as an indication of his deserved
supremacy. His first step was to carry out his father's sug-
gestion that the Anunnaki themselves build for him his
house/temple in Babylon, the E.SAG.IL ("House of Lofty
Head"). To that was added in the sacred precinct another
temple for the celebration of the New Year and the reading
of the revised Enuma elish; its name, E.TEMEN.AN.KI
("House of the Foundation Heaven-Earth") was clearly in-
tended to indicate that it had replaced Enlil's DUR.AN.KI
("Bond Heaven-Earth"), which had been at the heart of Nip-
pur when it was Mission Control Center.

Scholars have paid scant attentionto the issue of mathe-
matics in the Bible, leaving untackled what should have been
a puzzle: Why has the Hebrew Bible adopted completely the
decimal system, although Abraham was an Ibri — a Sumerian
from Nippur — and all the tales in Genesis (as echoed in the
Psalms and elsewhere) were based on Sumerian texts? Why
was the Sumerian sexagesimal system ("base 60") not at all

236 THE COSMIC CODE

echoed in the Bible's numerology — a practice that culmi-
nated in the concept of a millennium?

One wonders whether Marduk had been cognizant of this
issue. He marked his assumption of supremacy by proclaim-
ing a New Age (that of the Ram), by revising the calendar,
and by building a new Gateway of the Gods. In those steps
one can find evidence also for a new mathematics — a tacit
shift from the sexagesimal to the decimal system.

The focal point of those changes was the temple-ziggurat
honoring him, that Enki suggested be built by the Anunnaki
themselves. Archaeological discoveries of its remains (after
repeated rebuildings) as well as the information provided by
tablets with precise architectural data, reveal that the ziggurat
rose in seven stages, the topmost of which served as the
actual residence of Marduk. Planned (as Marduk himself had
claimed) "in accordance with the writings of the Upper
Heaven," it was a square structure whose base or first stage
measured 15 gar (about 300 feet) on each side and rising 5.5
gar (about 110 feet); atop that there was a second stage,
smaller and shorter; and so on, until the whole temple
reached a combined height of the same 300 feet as the bot-
tom base. The result was a cube whose circumference
equaled 60 gar in each of its three dimensions, giving the
structure the celestial number 3600 when squared (60 x 60)
and 216,000 when cubed (60 x 60 x 60). But in that number
was hidden a shift to the decimal system, for it represented
the zodiacal number 2,160 multiplied by 100.

The four corners of the ziggurat faced precisely to the four
cardinal points of the compass. As studies by archaeoastron-
omers have shown, the staggered height of each of the first
six stages was precisely calculated to enable celestial obser-
vations at that particular geographic location. The ziggurat
was thus intended not only to surpass Enlil's onetime Ekur,
but also to take over Nippur's astronomical/calendrical func-
tions.

This was carried out in practice by the institution of a
revision of the calendar — a matter of theological prestige as
well as of necessity, because the zodiacal shift (from Taurus

A Time of Prophecy 237

to Aries) also necessitated an adjustment of one month in the
calender if Nissan ("The Standard Bearer") was to remain
the first month and the month of the spring equinox. To
achieve that, Marduk ordered that the last month of the year,
Addaru, was to be doubled that year. (The device of doubling
Addar seven times within a cycle of nineteen years has been
adopted in the Hebrew calendar as a way to periodically
realign the lunar and solar years).

As in Mesopotamia, so was the calendar revised in Egypt.
Originally devised there by Thoth, whose "secret number"
was 52, it divided the year into 52 weeks of 7 days each,
resulting in a solar year of only 364 days (an issue prominent
in the Book of Enoch). Marduk (as Ra) instituted instead a
year based on a division into 10: he divided the year into 36
"decans" of ten days each; the resulting 360 days were then
followed by five special days, to complete 365.

The New Age ushered in by Marduk was not one of mono-
theism. Marduk did not declare himself sole god; indeed, he
needed the other gods to be present and to hail him as su-
preme. To that purpose he provided in the sacred precinct of
Babylon shrines, small temples and residences for all the
other principal gods, and invited them to make their homes
therein. There is no indication in any of the texts that any
accepted the invitation. In fact, at about the time that the
royal dynasty that Marduk had envisioned was finally in-
stalled in Babylon circa 1890 B.C., the dispersed gods began
to establish their own new domains all around Mesopotamia.

Prominent among them was Elam in the east, with Susa
(later the biblical Shushan) as its capital and Ninurta as its
"national god." In the west, a kingdom whose capital was
called Mari (from the term Amurru, the Western One) blos-
somed out into its own on the western banks of the Euphrates
River; its magnificent palaces were decorated with murals
showing Ishtar investing the king (Fig. 84), attesting to the
high standing of that goddess there. In the mountainous Hatti
Land, where the Hittites had already worshiped Enlil's youn-
gest son Adad by his Hittite name Teshub (the Wind/Storm
God), a kingdom with imperial strength and aspirations be-

238

THE COSMIC CODE

Figure 84

gan to grow. And between the Land of the Hittites and Bab-
ylonia there arose a brand-new kingdom — that of Assyria,
with a pantheon identical to mat of Sumer and Akkad, except
that the national god was named Ashur — the "Seeing One."
He combined the powers and identities of both Enlil and
Anu, and his depiction as a god within a winged circular
object (Fig. 85) dominated Assyrian monuments.

And, in distant Africa, there was Egypt, the Kingdom of
the Nile. But there a chaotic period, called by scholars the
Second Intermediate Period, removed the country from the
international scene until the so-called New Kingdom began
circa 1650 B.C.

Scholars are still hard put to explain why the ancient Near
East came astir just at that time. The new (17th) dynasty that
took control of Egypt was seized with imperial fervor, thrust-
ing into Nubia in the south, Libya in the west, and the lands
along the Mediterranean coast to the east. In the Land of the
Hittites, a new king sent his army across the barrier of the
Taurus Mountains, also along the Mediterranean coast; his
successor overran Man. And in Babylon, a people called
Cassites, appearing out of nowhere (actually, from the north-
eastern mountain region bordering on the Caspian Sea) at-

A Time of Prophecy 239

Figure 85

tacked Babylon and brought the dynasty that stalled with
Hammurabi to an abrupt end.

As each nation made the claim that they went on the war-
path in the name and on the orders of their national god, the
growing conflicts might well have represented a struggle be-
tween the gods through human surrogates. A clue that seems
to confirm this is the fact that the theophoric names of Phar-
aohs of the 18th dynasty dropped the prefix or suffix Ra or
Amen in favor of Thoth. The change, that began with Thoth-
mes (sometimes rendered Tuthmosis) I in 1525 B.C., also
marked the beginning of the oppression of the Israelites. The
reason given by the Pharaoh is enlightening: Launching mil-
itary expeditions to Naharin, on the Upper Euphrates, he
feared that the Israelites would become an internal fifth col-
umn. The reason? Naharin was the very area where Harran
was located, and where the people were descendants of the
Patriarchal relatives.

As much as this explains the given reasons for the op-
pression of the Israelites, it leaves unexplained why, and
what for, did the Egyptians — now venerating Thoth — send
armies to conquer distant Harran. It is a puzzle that bears
keeping in mind.

The military expeditions on the one hand and the concur-
rent oppression of the Israelites, peaking with the edict or-
dering the killing of all Israelite newborn males, reached a
climax under Thothmes III, forcing Moses to flee after he

240

THE COSMIC CODE

Figure 86

had stood up for his people. He could return to Egypt from
the Sinai wilderness only after the death of Thothmes III in
1450 B.C. Seventeen years later, after repeated demands and
a series of afflictions wrought by Yahweh upon "Egypt and
its gods," the Israelites were let go, and the Exodus began.

Two incidents mentioned in the Bible, and a major change
in Egypt, indicate theological repercussions among other
peoples as a result of the miracles and wonders attributed to
Yahweh in support of his Chosen People.

"And when Jethro, the Priest of Midian, the father-in-law
of Moses, heard of all that God had done for Moses and for
his people Israel," we read in Genesis chapter 18, he came
to the Israelite encampment, and after getting me full story
from Moses, Jethro said: "Now 1 know that Yahweh is
greater than all the gods;" and he offered sacrifices to Yah-
weh. The next incident (described in Numbers chapters 22-
24) occurred when the Moabite king retained the seer
Bile'am (also rendered Balaam) to put a curse on the ad-
vancing Israelites. But "the spirit of God came upon Bilam,"
and in a "divine vision" he saw mat the House of Jacob
was blessed by Yahweh, and mat His word cannot be coun-
termanded.

The recognition by a non-Hebrew priest and seer of the
powers and supremacy of Yahweh had an unexpected effect
on the Egyptian royal family. In 1379 B.C. — just as the Is-
raelites were entering Canaan proper — a new Pharaoh
changed his name to Akhenaten — the Aten being represented
by the Winged Disc (Fig. 86), moved his capital to a new

A Time of Prophecy 241

place, and began to worship one god. It was a short-lived
experiment to which the priests of Amen-Ra put a quick end
... Short-lived, too, was the concept of a universal peace that
accompanied the faith in a universal God. In 1296 B.C. the
Egyptian army, ever thrusting toward the Harran region, was
decisively defeated by the Hittites in the Battle of Kadesh
(in what is now Lebanon).

As the Hittites and Egyptians exhausted each other, there
was more room for the Assyrians to assert themselves. A
series of expansions virtually in all directions culminated in
the recapture of Babylon by the Assyrian king Tukulti-
Ninurta 1 — a theophoric name that indicates the religious al-
legiance — and the seizing of Babylon's god, Marduk. What
followed is typical of the polytheism of the time: Far from
denigrating the god, he was brought over to the Assyrian
capital and, when the time came for the New Year ceremo-
nies, it was Marduk, not Ashur, who featured in the age-old
rituals. This "unification of the churches," to coin an
expression, failed to stop the increasing exhaustion among
the once-imperial kingdoms; and for several ensuing centu-
ries, the two erstwhile powers of Mesopotamia joined Egypt
and Hatti Land in a retraction and loss of conquering zeal.

It was undoubtedly that withdrawal of imperial tentacles
that made possible the emergence of prosperous city-states
in western Asia, especially along the Mediterranean coast, in
Asia Minor, even in Arabia. Their rise, however, became a
magnet attracting migrants and invaders virtually from all
directions. Invaders who came in ships — the "Peoples of the
Sea" as the Egyptians called them — tried to settle in Egypt
and ended up occupying the coast of Canaan. In Asia Minor,
the Greeks launched a thousand ships against Troy. People
speaking Indo-European languages pushed their way into
Asia Minor and down the Euphrates River. The forerunners
of the Persians encroached on Elam. And in Arabia, tribes
that became wealthy from controlling trade routes cast their
eyes to me fertile lands to their north.

In Canaan, tired of constantly battling city-kings and
princedoms all around them, me Israelites sent, through the

242 THE COSMIC CODE

High Priest Samuel, a request to Yahweh: Make us one
strong nation, give us a king!

The first one was Saul; after him came David, and then
the transfer of the capital to Jerusalem.

The Bible lists Men of God during that period, even calls
them "prophets" in me strictest sense of me word: "spokes-
men" for God. They did deliver divine messages, but they
were more in me nature of oracle priests known elsewhere
in antiquity.

It was only after the Temple to Yahweh was built, that
prophecy — the foretelling of things to come — came into full
bloom. And there was nothing akin to the Hebrew Prophets
of the Bible, who combined me preaching of justice and mo-
rality with the foreseeing of tilings to come, anywhere else
in the ancient world.

The period that is now called in hindsight the first millen-
nium B.C. was actually the last millennium in the four-
thousand-year-old human story that began with the
blossoming out of the Sumerian civilization. The midpoint
in this human drama, whose story we have called The Earth
Chronicles, was the nuclear holocaust, the demise of Sumer
and Akkad, and the hand-over of the Sumerian baton to
Abraham and his seed. That was the watershed after the first
two thousand years. Now, the next half of the story, the last
two millennia of what had begun in Sumer and a state visit
to Earth by Anu circa 3760 B.C., was also coming to an end.

That, indeed, was the thread connecting the great bib-
lical prophecies at that time: The cycle is coming to a
closure, what had been foretold at the Beginning of Years
shall be coming true at the End of Years.

Mankind has been given an opportunity to repent, to return
to justice and morality, to recognize that there is only one
true God, the God even of the Elohim themselves. With
every word, vision, symbolic act the Prophets tolled the mes-
sage: Time is running out; great events are about to happen.
Yahweh does not seek the death of the evildoers — He seeks
their return to righteousness. Man cannot control his Destiny

A Time of Prophecy 243

but can control his Fate; Man, kings, nations, can choose the
course to follow. But if evil shall prevail, if injustice shall
rule human relations, if nation shall continue to take sword
to other nations, all shall be judged and doomed on the Day
of the Lord.

As the Bible itself acknowledges, it was not a message to
a receptive audience. Surrounded by peoples who seemed to
know whom they worshiped, the Jews were asked to adhere
to strict standards demanded by an unseen God, one whose
mere image was unknown. The true prophets of Yahweh had
their hands full facing "false prophets" who also claimed to
be delivering God's word. Sacrifices and donations to the
Temple will atone all sins, the latter said; Yahweh wants not
your sacrifices but that you live in justice, Isaiah said. Great
calamities will befall the unrighteous, Isaiah said; No, no —
Peace is coming, the false prophets said.

To be believed, the biblical Prophets resorted to miracles —
just as Moses, instructed by God, had to resort to miracles
to obtain the Pharaoh's release of the Israelites, and then to
convince the Israelites of Yahweh's almightiness.

The Bible describes in detail the difficulties faced by the
Prophet Elijah during the reign (in the northern kingdom.
Israel) of Ahab and his Phoenician wife Jezebel, who brought
with her the worship of the Canaanite god Ba'al. Having
already established his reputation by making a poor woman's
flour and oil last and last, and by reviving a boy who had
died, Elijah's greatest challenge was a confrontation with the
"prophets of Ba'al" on Mount Carmel. Who was a "true
prophet" was to be determined, in front of an assembled
multitude headed by the king, by the performance of a mir-
acle: A sacrifice on a pile of wood was readied, but no fire
was lit — the fire had to come from heaven. And the prophets
of Ba'al called in the name of Ba'al from morning till noon,
but there was no sound and no answer (1 Kings chapter 18).
Mocking them, Elijah said: Perhaps your god is asleep — why
don't you call to him much louder? And they did till evetime,
but nothing happened. Then Elijah took stones and rebuilt
an altar to Yahweh that was in ruins, and arranged the wood

244 THE COSMIC CODE

and the sacrificial ox on it, and asked the people to pour
water on the altar, to make sure there was no hidden fire
there. And he called the name of Yahweh, the god of Abra-
ham and Isaac and Jacob; "and a fire of Yahweh decsended
upon the sacrifice and it and the altar were burnt down."
Convinced of Yahweh's supremacy, the people seized the
prophets of Ba'al and killed them all.

After Elijah was taken up to heaven in a fiery chariot, his
disciple and successor Elisha also performed miracles to es-
tablish his authenticity as a true Prophet of Yahweh. He
turned water blood red, revived a dead boy, filled up empty
vessels from a minute amount of oil, fed a hundred people
with a bit of leftover food, and made a bar of iron float on
water.

How believable were such miracles then? We know from
the Bible — the tales from the time of Joseph and then me
Exodus — as well as from Egyptian texts themselves, such as
the Tales of the Magicians, that the royal court there had its
fill of magicians and soothsayers. Mesopotamia had omen-
priests and oracle priests, diviners and seers, and solvers of
dreams. Nevertheless, when a scholarly discipline called Bi-
ble Criticism became fashionable in the nineteenth century
A.D., such tales of miracle-making added to the insistence
that everything in the Bible must be supported by indepen-
dent sources to be believed. Fortunately, among the earliest
finds by archaeologists in the nineteenth century was an in-
scribed stela of the Moabite king Mesha, in which he not
only corroborated data regarding Judea in the lime of Elijah,
but was one of the rare extrabiblical mentions of Yahweh by
His full name (Fig. 87). Though this is no corroboration of
the miracles themselves, this find — as others later on — went
far to authenticate events and personalities recorded in the
Bible.

While the texts and artifacts discovered by archaeologists
provided corroboration, they also shed light on profound dif-
ferences between the biblical Prophets and those fortune-
tellers of other nations. From the very beginning the Hebrew
Nebi'im — translated "prophets" but literally meaning

A Time of Prophecy

245

'**£** <iwm *»w+»^ P ^^ P* ** "''^t** I

.■Tin'' i" wy i pz* ■ * i * -*r i *n*"t '

*,-. N ^ T .» n , i » V .»jr. T .— t.fi.^-Ki .

-■ 17. *f*4 «^*f^T3 it 4 ^^ f * j fit *

« m/i»o.ij * rri -1 3 mm? ■ y * • j-i-Ttff j*
•JQH uuymffo) "VHP 1 'f*f***£* m '

I sgjpsjw

-3Yf-

Figure 87

"spokesmen" of God — explained that the magic and fore-
sight were not theirs but God's. The miracles were His, and
what was foretold was just what God had ordained. More-
over, rather than acting as court employees, as "Yes-men
prophets," they as often as not criticized and admonished
the high-and-mighty for personal wrongdoing or wrong na-
tional decisions. Even King David was reprimanded for cov-
eting the wife of Uriah the Hittite.

By an odd coincidence — if that is all it was — at the same
time that David captured Jerusalem and took the initial steps
to establish the House of Yahweh on the Sacred Platform,
the decline and decay of what is termed Old Assyria came
to an abrupt end and, under a new dynasty, what historians

246 THE COSMIC CODE

call the Neo-Assyrian period was ushered in. And no sooner
was the Temple of Yahweh built, than Jerusalem began to
attract the attention of distant rulers. As a direct consequence,
its prophets, too, shifted their sights to the international
arena, and embedded prophecies concerning the world at
large within their prophecies regarding Judea, the split-off
northern kingdom of Israel, their kings, and their peoples. It
was a worldview that was amazing in its scope and under-
standing — by Prophets who, before they were summoned by
God, were mostly simple villagers.

Such profound knowledge of distant lands and nations, the
names of their kings (in one instance, even a king's nick-
name), their commerce and trade routes, their armies and
makeup of fighting forces, must have amazed even the kings
of Judea at the time. Once, at least, an explanation was
spelled out. It was Hanani the Prophet who (warning the
Judean king against a treaty with the Aramaeans) explained
to the king: Rely on the word of Yahweh, for "it is the eyes
of Yahweh that roam the whole Earth."

In Egypt, too, a period of disunity ended when a new
dynasty, the 22nd, reunited the country and relaunched the
involvement in international affairs. The new dynasty's first
king, the Pharaoh Sheshonq, seized the historical first of be-
ing the first foreign ruler of one of the then-great powers to
forcefully enter Jerusalem and seize its treasures (without,
however, damaging or defiling the Temple). The event, oc-
curring in 928 B.C., is related in 1 Kings 14 and in 2 Chron-
icles 12: it was all foretold by Yahweh to the Judean king
and his noblemen ahead of time by the Prophet Shemaiah;
it was also one of the instances where the biblical account
has been corroborated by an outside, independent record —
in this case by the Pharaoh himself, on the southern walls of
the temple of Amen in Karnak.

Assyrian encroachments on the Jewish kingdoms, accu-
rately recorded in the Bible, began with the northern king-
dom, Israel. Here again, biblical records are fully
corroborated by the annals of the Assyrian kings: Shalma-
neser III (858-824 B.C.) even pictured the Israelite king Jehu

A Time of Prophecy 247

ITS tT^Vt* a. 4"Vfl| IcflB J

Figure ',

bowing down before him, in a scene dominated by the
Winged Disc symbol of Nibiru (Fig. 88a). Some decades
later another Israelite king warded off an attack by prepaying
tribute to the Assyrian king Tiglat-Pileser III (745-727 B.C.).
But that only gained some time: in 722 B.C. the Assyrian
king Shalmaneser V marched on the northern kingdom, cap-
tured its capital Samaria (Shomron — '"Little Sumer" — in
Hebrew), and exiled its king and noblemen. Two years later
the next Assyrian king, Sargon II (721-705 B.C.) exiled the
rest of the people — giving rise to the enigma of the Ten Lost
Tribes of Israel — and ended the independent existence of that
state.

The Assyrian kings began each record of their numerous
military campaigns with the words "On the command of my
god Ashur," giving their conquests the aura of religious
wars. The conquest and subjugation of Israel was so impor-
tant that Sargon, recording his victories on the walls of his
palace, began the inscription by identifying himself as "Sar-
gon, conqueror of Samaria and of the entire land of Israel."
With that achievement, crowning his conquests elsewhere,
he wrote, "I aggrandized the territory belonging to Ashur,
the king of the gods."

248 THE COSMIC CODE

While those calamities, according to the Bible, befell the
northern state Israel because its leaders and people failed to
heed the Prophets' warnings and admonitions, the kings of
Judea to the south were more attentive to the prophetic guid-
ance and, for a while, enjoyed a period of relative peace. But
the Assyrians had their eye on Jerusalem and its temple; and
for reasons which their annals do not explain, many of their
military expeditions started in the Harran area and then ex-
tended westward to the Mediterranean coast. Significantly,
the annals of the Assyrian kings, describing their conquests
and domains in the Harran area, identify by name a city
called Nahor and a city called Laban — cities bearing the
names of the brother and brother-in-law of Abraham.

The turn of Judea and specifically Jerusalem to come un-
der Assyrian attack was not long in coming. The task of
extending the territories and the "command" of the god
Ashur to the House of Yahweh fell to Sennacherib, the son
of Sargon II and his successor in 704 B.C. Aiming to con-
solidate his father's conquests and put an end to recurring
rebellions in Assyrian provinces, he devoted his third cam-
paign (701 B.C.) to the capture of Judea and Jerusalem.

The events and circumstances of that attempt are exten-
sively recorded both in the Assyrian's annals and in the Bi-
ble, making it one of the best documented instances of
biblical veracity. It was also an occurrence that showed the
veracity of the biblical prophecy, its value as a foretelling
guide, and the scope of its geopolitical grasp.

Furthermore, there exists physical evidence — to this
very day — corroborating and illustrating an important
aspect of those events; so that one can see with one's own
eyes how real and true it all was.

As we start relating those events with the words of Sen-
nacherib himself, let it be noticed that here again the cam-
paign against distant Jerusalem began with a detour to "Hatti
Land," to the area of Harran, and only then swung all the
way westward to the Mediterranean coast, where the first city
attacked was Sidon:

A Time of Prophecy

249

f ft ffMlftHi * I

m r*«, 4* rf U

»(*)

'>. *

p00 J-f /?— JC*"*— *ff-

iMO.lMi

LMtfe **4 ■fcacp, i

Figure 88b

In my third campaign I marched against Haiti.
Luli, king of Sidon, whom the terror-inspiring
glamor of my lordship had overwhelmed,
fled far overseas and perished.

The awe-inspiring splendor of the Weapon of Ashur,
my lord, overwhelmed the strong cities of Greater

Sidon.. .
All the kings from Sidon to Arvad, Byblos, Ashdod,
Beth- Amnion, Moab and Adorn brought sumptuous

gifts;
the king of Ashkelon I deported to Assyria...

The inscription (Fig. 88b) continued:

As for Hezekiah the Judean
who did not submit to my yoke

250 THE COSMIC CODE

46 of his strong walled cities

as well as the small cities in their neighborhood

which were without number...

I besieged and took them and

200,150 people old and young male and female

horses, mules, camels, asses, cattle and sheep

I brought away from them.

In spite of these losses, Hezekiah remained unyielding —
because the Prophet Isaiah had thus prophesied: Fear not
the attacker, for Yahweh will impose His spirit on him,
and he shall hear a rumor, and will return to his land, and
there he will be felled by the sword ... "Thus sayeth Yah-
weh: the king of Assyria shall not enter this city! The way
he came he shall go back, for I protect this city to save it,
for My sake and for the sake of David my servant." (2 Kings
chapter 19).

Defied by Hezekiah, Sennacherib went on to state thus in
his annals:

In Jerusalem, I made Hezekiah

a prisoner in his royal palace,

like a bird in a cage, surrounding him

with earthworks, molesting those who

left by the city gates.

"I then took away districts of Hezekiah's kingdom and
gave them away to the kings of Ashdod and Ekron and
Gaza — Philistine city-states — and increased the tribute on
Hezekiah," Sennacherib wrote; and then he listed the tribute
that Hezekiah "sent to me later in Nineveh."

Almost imperceptibly thus, the annals mention neither the
capture of Jerusalem nor the seizing of its king — just the
imposition of heavy tribute: gold, silver, precious stones, an-
timony, cut red stones, furnishings inlaid with ivory, elephant
hides "and all kinds of valuable treasure."

The boasting omits telling what had really happened in
Jerusalem; the source for the more complete story is the Bi-

A Time of Prophecy 251

ble. It records, in 2 Kings chapter 20 and, similarly, in the
book of the Prophet Isaiah and in the Book of Chronicles,
that "in the fourteenth year of Hezekiah, Sennacherib the
king of Assyria came upon all of the fortified cities of Judea
and captured them. Then Hezekiah the king of Judea sent
word to the king of Assyria, who was in Lachish, saying: I
have done wrong; turn back, and whatever you impose on
me I shall endure. So the king of Assyria imposed on Hez-
ekiah the king of Judea three hundred bars of silver and thirty
bars of gold;" and Hezekiah paid it all, including as an extra
tribute the bronze inlays of the temple and palace doors, and
handed them over to Sennacherib.

But the king of Assyria reneged on the deal. Instead of
retreating back to Assyria, he sent a large force against the
Judean capital; and as the Assyrian siege tactic had been, the
first thing the attackers did was to seize the city's water res-
ervoirs. The tacdc worked elsewhere, but not in Jerusalem.
For, unbeknown to the Assyrians. Hezekiah had a water tun-
nel dug under the city's walls, diverting the plentiful waters
of the Spring of Gihon to the Pool of Silo'am inside the city.
This subterranean secret water tunnel provided the besieged
city with fresh water, defying the Assyrians' plans.

Frustrated by the failure of the siege to subdue the city,
the Assyrian commander turned to psychological warfare.
Speaking in Hebrew so that the common defenders would
understand, he pointed out the futility of resistance. None of
the other nations' gods could save them; who is this "Yah-
weh" and why would he do better for Jerusalem? He was a
god as fallible as the others ...

Hearing all that, Hezekiah tore his clothes and put on a
mourner's sackcloth, and went to the Temple of Yahweh,
and prayed to "Yahweh the God of Israel, who abides upon
the Cherubim, the sole God upon all the nations, the maker
of the Heaven and the Earth." Assuring him that his prayer
was heard, the Prophet reiterated the divine promise: The
Assyrian king shall never enter the city: he will return home
in failure, and there he will be assassinated.

252 THE COSMIC CODE

That night a divine miracle happened, and the first part of
the prophecy came true:

And it came to pass that night,

that the Angel of Yahweh went forth

and smote in the camp of the Assyrians

a hundred and eighty five thousand.

And at sunrise, to and behold:

they were all dead corpses.

So Sennacherib, the king of Assyria, departed

and journeyed back and dwelt in Nineveh.

2 Kings 19:35-36

In a postscript, the Bible made sure to record that the sec-
ond part of the prophecy had also come true, adding "And
Sennacherib went away, and journeyed back to Nineveh.
And it was when he was bowing down in his temple to his
god Nisrokh, mat Adramelekh and Sharezzer struck him
down with a sword; and they fled to the land of Ararat. His
son Esarhaddon became king in his stead."

The biblical postscript regarding the manner in which Sen-
nacherib died has long puzzled scholars, for the royal As-
syrian annals left the king's death a mystery. Only recently
did scholars, with me aid of additional archaeological finds,
confirm the biblical account: Sennacherib was indeed assas-
sinated (in the year 681 B.C.) by two of his own sons, and
the heir to the throne became another, younger son called
Esarhaddon.

We, too, can add a postscript to further confirm the ve-
racity of the Bible.

Early in the nineteenth century, archaeologists exploring
Jersalem discovered that the Tunnel of Hezekiah was fact,
not myth: that a subterranean tunnel indeed served as a con-
duit for a secret supply of water in Jerusalem, cut through
the city's native rock under me defensive walls from the time
of the Judean kings !

In 1838 the explorer Edward Robinson was the first in
modern times to traverse its full length, 1,750 feet. In the

A Time of Prophecy

253

Figure 89

ensuing decades other renowned explorers of ancient Jeru-
salem (Charles Warren, Charles Wilson. Claude Conder,
Conrad Schick) cleared and examined the tunnel and its var-
ious shafts. It indeed connected the water's source at the
Spring of Gihon (outside the defensive walls) to the Pool of
Silo'am inside the city (Fig. 89). Then, in 1880, playing boys
discovered that about midway in the tunnel an inscription
had been carved into the wall. The Turkish authorities of the
time ordered that the inscribed segment of the wall be ex-
cised and brought to Istanbul (the Turkish capital). It was
then ascertained that the inscription (Fig. 90), in beautiful
ancient Hebrew script current at the time of the Judean kings,
commemorated the completion of the tunnel when the tun-
nelers of Hezekiah, cutting through the rock from both ends,
met at that very spot where the inscription was found.
The inscription (on the piece of rock excised from the

254 THE COSMIC CODE

Figure 90

tunnel's wall), which is on display in the Istanbul Archaeo-
logical Museum, renders the following account:

... the tunnel. And this is the account of the break-
through. When [the tunnelers lifted] the axe each to-
ward his fellow, and while there were still three cubits
to be tunneled [through], the voice of a man was heard
calling to his fellow, for there was a crack in the rock
on the right... And on the day of me breakthrough
the tunnelers struck each toward his comrade, axe to-
ward axe. And me water started to flow from its source
to the pool, a thousand and two hundred cubits; and
the height of the rock above the heads of the tunnelers
was one hundred cubits.

The accuracy and veracity of the biblical account of the
events in Jerusalem extended to the events in faraway Nin-
eveh concerning the succession on the throne of Assyria: It
was indeed a bloody affair that pitted sons of Sennacherib
against him and ended with me younger son, Esarhaddon
(also spelled Asarhaddon), ascending me throne. The bloody
events are described in the Annals of Esarhaddon (on the
artifact known as Prism B), in which he ascribes his choice
to kingship over his older brothers as the result of an oracle
given to Sennacherib by the gods Shamash and Adad — a
choice approved by the great gods of Assyria and Babylon
"and all the other gods residing in heaven and on Earth."

A Time of Prophecy 255

The bloody end of Sennacherib was but one act in a raging
drama concerning the role and standing of the god Marduk.
The Assyrian attempt to bring the Babylonians to heel and
in reality annex Babylon by bringing Marduk over to the
Assyrian capital did not work, and within decades Marduk
was returned to his honored position in Babylon. The texts
suggest that a crucial aspect of the god's restoration was the
need to celebrate the Akitu festival of the New Year, in
which the Enuma elish was publicly read and the Resurrec-
tion of Marduk was reenacted in a Passion Play, in Babylon
and nowhere else. By the time of Tiglat-Pileser III, the king's
legitimacy required his humbling himself before Marduk un-
til Marduk "took both my hands in his" (in the king's
words).

To cement his choice of Esarhaddon as his successor, Sen-
nacherib had appointed him as Babylon's viceroy (and
named himself "King of Sumer and Akkad"). And when he
ascended the throne, Esarhaddon took the solemn oath of
office "in the presence of the gods of Assyria: Ashur, Sin,
Shamash, Nebo, and Marduk." (Ishtar, though not present,
was invoked in later annals).

But all those efforts to be religiously inclusive failed to
bring stability or peace. As the seventh century B.C. began,
ushering in the second half of what, counting forward from
the Sumerian start, was the Last Millennium, turmoil seized
the great capitals and spread throughout the ancient world.

The biblical Prophets saw it all coming; it was the be-
ginning of the End, they announced in behalf of Yahweh.

In the prophesied scenario of events to come, Jerusalem
and its Sacred Platform were to be the focal point of a global
catharsis. The divine fury was to manifest itself first against
the city and its people, for they had abandoned Yahweh and
his commandments. The kings of the great nations were to
be the instruments of Yahweh's wrath. But then they, too,
each one in his turn, would be judged on the Day of Judg-
ment. "It will be a judgment upon all flesh, for Yahweh has
a quarrel with all the nations," the Prophet Jeremiah an-
nounced.

256 THE COSMIC CODE

Assyria, the Prophet Isaiah quoted Yahweh as saying, was
his punishing cane; he foresaw its sweeping down upon
many nations, even invading Egypt (a prophecy that did
come true); but then Assyria, too, would be judged for its
sins. Babylon was to be next, the Prophet Jeremiah said; its
king would come upon Jerusalem, but seventy years later (as
indeed came to be) Babylon, too, would be brought to heel.
The sins of nations great and small, from Egypt and Nubia
all the way to distant China (!) were to be judged on the Day
of Yahweh.

One by one, the prophecies were fulfilled. Of Egypt the
Prophet Isaiah foresaw its occupation by Assyrian forces af-
ter a three-year war. The prophecy came true at the hands of
Esarhaddon, Sennacherib's successor. What is remarkable,
beside the fact of the prophecy's fulfillment, is that before
leading his army westward then southward toward Egypt, the
Assyrian king made a detour to Harran!

That was in 675 B.C. In the same century, the fate of As-
syria itself was sealed. A resurgent Babylon under king Na-
bupolassar captured me Assyrian capital Nineveh by
breaking the river dams to flood the city — just as the Prophet
Nahum had foretold (1:8). The year was 612 B.C.

The remnants of the Assyrian army retreated — of all
places — to Harran; but mere the ultimate instrument of di-
vine judgment made its appearance. It would be, Yahweh
told Jeremiah (Jeremiah 5:15-16), "a distant nation ... a na-
tion whose language thou knowest not:"

Behold,

a people cometh from a country in the north,

a great nation shall be roused

from the remoteness of the Earth.

They grasp hows and spears,

they are cruel, they show no mercy.

The sound of them is like the roaring sea,

they ride upon horses.

arrayed as men of battle.

Jeremiah 6:22-23

A Time of Prophecy 257

The Mesopotamian records of the time speak of the sudden
appearance, from the north, of the Umman-Manda — perhaps
advance hordes of Scythians from central Asia, perhaps fore-
runners of the Medes from the highlands of what is now Iran,
perhaps a combination of both. In 610 B.C. they captured
Harran. where the remnants of the Assyrian army holed up.
and gained control of the vital crossroads. In 605 B.C. an
Egyptian army headed by the Pharaoh Necho thrust once
again — as Thothmes III had attempted before the Exodus —
to reach and capture Naharin, on the Upper Euphrates. But
a combined force of Babylonians and Umman-Manda, at a
crucial battle at Carcemish near Harran, gave Egypt's empire
the final coup de grace. It was all as Jeremiah had prophesied
concerning haughty Egypt and its king Necho:

Like a river that riselh and as surging streams

has been Egypt, [saying/

I will rise, I will cover the Earth.

I will wipe out towns and all who dwell therein . . .

But that day.

the day of Yahweh. Lord of Hosts, shall be,

a day of retribution.

in the land of the north, by the Euphrates River...

Thus sayeth Yahweh, Lord God of Israel:
"I have made commandments upon Amen of Thebes,
and upon Pharaoh, and upon Egypt and its gods
and its kings — on Pharaoh and all who on him rely:
Into the hands of those who seek to kill them.
Into the hands of Nebuchadnezzar king of Babylon
and into the hands of his subjects
I shall deliver them."

Jeremiah chapter 46

Assyria was vanquished — the victor has become a victim.
Egypt was beaten and its gods disgraced. There was no
power left to stand in the way of Babylon — nor for Babylon

258 THE COSMIC CODE

to act out Yahweh's wrath against Judea, and then meet her
own fate.

At the helm of Babylon was now a king of Caesarian
ambitions. He was given the throne in recognition of the
victory at Carchemish and the royal name Nebuchadnezzar
(the second), a theophoric name incorporating the name of
Nabu, Marduk's son and spokesman. He lost no time launch-
ing military campaigns '"by the powers of my lords Nabu
and Marduk." In 597 B.C. he sent his forces to Jerusalem,
ostensibly only to remove its pro-Egyptian king Jeho'iakim
and replace him with his son Jeho'iachin, a mere youth. It
was only, it turned out, a test run; for one way or another,
he was fated to play out the role Yahweh had assigned to
him as the punisher of Jerusalem for the sins of its people;
but ultimately, Babylon herself would be judged:

This is the word of Yahweh concerning Babylon —

Declare it among the nations.

raise a standard and proclaim,

deny nothing, announce:

Captured is Babylon.

its Lord is shamed, Marduk is dismayed;

its idols are withered, her fetishes cowered'.

For a nation from the north hath come upon her

from the north;

it will make her land desolate, without dwellers.

Jeremiah 50:1-3

It will be an Earthwide catharsis, in which not only nations
but also their gods shall be called to account, Yahweh, the
"Lord of Hosts," made clear. But at the end of the catharsis,
after the coming of the Day of the Lord, Zion shall be rebuilt
and all the nations of the world shall gather to worship Yah-
weh in Jerusalem.

When all is said and done, the Prophet Isaiah declared,
Jerusalem and its rebuilt Temple would be the sole "Light
unto the nations." Jerusalem shall suffer its Fate, but will
arise to fulfill its Destiny:

A Time of Prophecy 259

And it shall come to pass

at the End of Days:

The Mount of the Temple of Yahweh

shall be established ahead of all mountains

and shall be exalted above all hills:

And all the nations shall throng unto it.

And many peoples shall come and say:

'Come ye. let us go up to the Mountain of Yahweh,

to the Temple of the God of Jacob,

that He may teach us of his ways and

that we may follow in His path:

for out of Zon shall come instruction

and the word of God from Jerusalem'.

Isaiah 2:2-3

In those unfolding events and prophecies concerning the
great powers, Jerusalem and its Temple, and what is to come
in the Last Days, the Prophets in the Holy Land were joined
by the Prophet Ezekiel who was shown Divine Visions on
the banks of the Khabur River in faraway Harran.

For there, in Harran, the divine and human drama that
began when the paths of Marduk and Abraham crossed, was
also destined to come to an end — at the very same time that
Jerusalem and its Temple were facing Fate.

12

THE GOD WHO RETURNED
FROM HEAVEN

Was the crossing of the paths of Marduk and Abraham in
Harran just a chance coincidence, or was Harran chosen by
the unseen hand of Fate?

It is a nagging question, calling for a divining answer, for
the place where Yahweh had chosen Abram for a daring
mission and where Marduk made his reappearance after an
absence of a thousand years, was later on the place where a
series of incredible events — miraculous events, one could
well say — began to unfold. They were occurrences of pro-
phetic scope, affecting the course of both human and divine
affairs.

The key events, recorded for posterity by eyewitnesses,
began and ended with the fulfillment of the biblical proph-
ecies concerning Egypt, Assyria, and Babylon; and they in-
cluded the departure of a god from his temple and his city,
his ascent to the heavens, and his return from the heavens a
half century later.

And, for a reason perhaps more metaphysical than geo-
graphic or geopolitical, so many of the crucial events of the
last two millennia of the count that began when the gods,
meeting in council, decided to give Mankind civilization,
took place in or around Harran.

We have already mentioned in passing the detour of Esar-
haddon to Harran. The details of that pilgrimage were re-
corded on a tablet that was part of the royal correspondence
of Ashurbanipal, Esarhaddon's son and successor. It was
when Esarhaddon contemplated an attack on Egypt, he
turned northward instead of westward and looked for "the

260

The God Who Returned from Heaven 261

cedarwood temple" in Harran. There "he saw the god Sin
leaning on a staff, with two crowns on his head. The god
Nusku was standing before him. The father of my majesty
the king entered the temple. The god placed a crown upon
his head, saying: 'You will go to countries, therein you will
conquer!' He departed and conquered Egypt." (Nusku, we
know from Sumerian God List, was a member of Sin's en-
tourage).

The invasion of Egypt by Esarhaddon is a historical fact,
fully making true Isaiah's prophecy. The details of the detour
to Harran additionally serve to confirm the presence there, in
673 B.C., of the god Sin; for it was several decades later that
Sin "became angry with the city and its people" and was
gone — to me heavens.

Nowadays Harran still stands where it did in the time of
Abraham and his family. Outside me city's crumbling walls
(walls from Islamic-conquest times) the well where Jacob
met Rebecca still flows with water, and in the surrounding
plain sheep still graze as they did four millennia ago. In
centuries past Harran was a center of learning and literature,
where me Greeks after Alexander gained access to the ac-
cumulated "Chaldean" knowledge (the writings of Berossus
were one of the results) and much later the Moslems and
Christians exchanged cultures. But me pride of the place
(Fig. 91) was me temple dedicated to the god Sin, in whose
ruins written testimony of the miraculous events concerning
Nannar/Sin has survived me millennia.

The testimony was not hearsay; it consisted of eyewitness
reports. They were not anonymous witnesses, but a woman
named Adda-Guppi and her son Nabuna'id. They were not,
as happens nowadays, a country sherrif and his mother re-
porting a UFO sighting in some sparsely inhabited area. She
was the High Priestess of the great temple of Sin. a sacred
and revered shrine since millennia before her time; her son
was the last king of the mightiest empire on Earth in those
days, Babylon.

The High Priestess and her son the king recorded the
events on stelae — stone columns inscribed in cuneiform

262

THE COSMIC CODE

Figure 91

script, accompanied by pictorial depictions. Four of them
have been found this century by archaeologists, and it is be-
lieved that the stelae were placed by the king and his mother
each at each corner of the renowned temple to the Moon god
in Harran, the E.HUL.HUL ("Temple of Double Joy"). One
pair of stelae carried the mother's testimony, the other pair
recorded the king's words. It was on the stelae of Adda-
Guppi, the temple's High Priestess, that the departure and
heavenly ascent of the god Sin were recorded; and it was in
the inscriptions of the king, Nabuna'id, that the god's mi-
raculous and unique return was reported. With an evident
sense of history and in me manner of a trained temple offi-
cial, Adda-Guppi provided in her stelae precise dates for the

The God Who Returned from Heaven 263

astounding events; the dates, linked as was then customary
to regnal years of known kings, could thus be — and have
been — verified by modern scholars.

In the better-preserved stela, cataloged by scholars as H^B,
Adda-Guppi began her written testimony (in the Akkadian
language) thus:

I am the lady Adda-Guppi,

mother of Nabuna 'id, king of Babylon,

devotee of the gods Sin, Ningal, Nusku

and Sadarnunna, my deities,

to whose godliness I have been pious

ever since my childhood.

She was born, Adda-Guppi wrote, in the twentieth year of
Ashurbanipal, king of Assyria — in the middle of the seventh
century B.C. Though in her inscriptions Adda-Guppi does not
state her genealogy, other sources suggest that she stemmed
from a distinguished lineage. She lived, according to her in-
scription, through the reigns of several Assyrian and Baby-
lonian kings, reaching the ripe old age of ninety-five when
the miraculous events had taken place. Scholars have found
her listing of reigns to be in accord with Assyrian and Bab-
ylonian annals.

Here then is the record of the first remarkable occurrence,
in Adda-Guppi's own words:

It was in the sixteenth year of Nabupolassar,

king of Babylon, when Sin, lord of gods,

became angry with his city and his temple

and went up to heaven;

and the city and the people in it

went to ruin.

The year bears noticing, for events — known from other
sources — had taken place at that time, corroborating what
Adda-Guppi had recorded. For the year was 610 B.C. — when

264 THE COSMIC CODE

the defeated Assyrian army retreated to Harran for a last
stand.

There are quite a number of issues that call for clarification
as a result of this statement: Was Sin "angry with the city
and its people" because they let the Assyrians in? Did he
decide to leave on account of the Assyrians, or the approach-
ing Umman-Manda hordes? How, by what means, did he go
up to heaven — and where did he go? To another place on
Earth, or away from Earth, a celestial place? The writings of
Adda-Guppi gloss over these issues, and for the moment we,
too, shall leave the questions hanging.

What the High Priestess does state is that after the depar-
ture of Sin "the city and the people in it went to ruin." Some
scholars prefer to translate the word in the inscription as
"desolate." as better describing what had happened to the
once-thriving metropolis, a city whom the Prophet Ezekiel
(27:23) listed among the great international trading centers
of the time, specializing "in all sorts of things, in blue
clothes, and broidered work, and in chests of rich apparel,
bound with cords and made of cedar." Indeed, the desolation
in the abandoned Harran brings to mind the opening words
of the biblical Book of Lamentations about the desolate and
desecrated Jerusalem: "How solitary lies the city, once so
full of people! Once great among the nations, now become
a widow; once queen among the provinces, now become a
tributary."

While others fled, Adda-Guppi stayed on. "Daily, without
ceasing, by day and night, for months, for years," she went
to the abandoned shrines. Mourning, she forsook the dresses
of fine wool, took off her jewels, wore neither silver nor
gold, relinquished perfumes and sweet-smelling oils. As a
ghost roaming the empty shrines, "in a torn garment I was
clothed, I came and went noiselessly," she wrote.

Then, in the abandoned sacred precinct, she discovered a
robe that had once belonged to Sin. It must have been a
magnificent garment, in the manner of robes worn at the time
by various deities, as depicted on monuments from Meso-
potamia (see Fig. 28). To the despondent High Priestess, the

The God Who Returned from Heaven 265

find seemed an omen from the god; it was as though he had
suddenly given her a physical presence of himself. She could
not lake her eyes off the sacred garb, daring not to touch it
except by "taking hold of its hem." As if the god himself
was there to listen, she prostrated herself and ' 'in prayer and
humility" uttered the following vow:

If you would return to your city,
all the Black-Headed people
would worship your divinity!

"Black-Headed people" was a term used by the Sumeri-
ans to describe themselves; and the employment of the term
by the High Priestess in Harran was highly unusual. Sumer,
as a political-religious entity, had ceased to exist almost
1,500 years before me time of Adda-Guppi. when the land
and its capital, the city of Ur, fell victim to a deadly nuclear
cloud in 2024 B.C. Sumer, by Adda-Guppi's time, was just
a hallowed memory, its erstwhile capital Or a place of crum-
bling ruins, its people (the "Black-Headed" people) dis-
persed to many lands. How then could a High Priestess in
Harran offer to her god Sin to restore him to lordship in
distant Ur, and to make him again the god of all the Sume-
rians, wherever they had dispersed?

It was a true vision of the Return of the Exiles and a
Restoration of a god in his ancient cult center worthy of
biblical prophecies. To achieve that, Adda-Guppi proposed
her god a deal: If he would return and then use his authority
and divine powers to make her son Nabuna'id the next im-
perial king, reigning in Babylon over both the Babylonian
and Assyrian domains — Nabuna'id would restore the temple
of Sin in Ur and would reinstate the worship of Sin in all
the lands where the Black-Headed people dwelt!

The Moon god liked the idea. "Sin, lord of me gods of
Heaven and Earth, for my good doings looked upon me with
a smile; he heard my prayers, he accepted my vow. The
wrath of his heart calmed; toward Ehulhul, the temple of Sin
in Harran, the divine residence in which his heart rejoiced,

266 THE COSMIC CODE

he became reconciled; and he had a change of heart."

The smiling god, Adda-Guppi wrote on in her inscription,
accepted the deal:

Sin, lord of the gods,

looked with favor upon my words.

Nabuna'id, my only son,

issue of my womb,

to the kingship he called —

the kingship of Sumer and Akkad.

All the lands from the border of Egypt,

from the Upper Sea to the Lower Sea,

in his hands he entrusted.

Grateful and overwhelmed, Adda-Guppi raised her hands
and "reverently, with imploration" thanked the god for
"pronouncing the name of Nabuna'id, calling him to king-
ship." Then she implored the god to assure the success of
Nabuna'id — to persuade the other great gods to be at
Nabuna'id's side as he battled the enemies, to enable him to
fulfill the vow to rebuild the Ehulhul temple and restore Har-
ran to its greatness.

In a postscript added to the inscriptions when Adda-Guppi,
aged 104, was on her deathbed (or recording her words right
after she had passed on), the text reported that both sides
kept their bargain: "I myself saw it fulfilled;" Sin "honored
his word which he spoke to me," causing Nabuna'id to be-
come king of a new Sumer and Akkad (in SSS B.C.); and
Nabuna'id kept the vow to restore the Ehulhul temple in
Harran, "perfected its structure." He renewed the worship
of Sin and his spouse Ningal — "all the forgotten rites he
made anew." And the divine couple, accompanied by the
divine emissary Nusku and his consort (?) Sadarnunna, re-
turned into the Ehulhul temple in a solemn and ceremonial
procession.

The duplicate stela's inscription contains nineteen addi-
tional lines undoubtedly added by Adda-Guppi's son. In the
ninth year of Nabuna'id — in 546 B.C. — "the Fate of herself

The God Who Returned from Heaven 267

carried her off. Nabuna'id, king of Babylon, her son, issue
of her womb, entombed her corpse, wrapped in [royal] robes
and pure white linen. He adorned her body with splendid
ornaments of gold set with beautiful precious stones. With
sweet oils he anointed her body; and laid it to rest in a secret
place."

The mourning for the king's mother was widespread.
"People from Babylon and Borsippa, dwellers of far regions,
kings, princes, and governors came from the border of Egypt
on the Upper Sea unto the Lower Sea" — from the Mediter-
ranean to the Persian Gulf. The mourning, which included
casting ashes upon the head, weeping, and self-inflicted cuts,
lasted seven days.

Before we rum to the inscriptions of Nabuna'id and their
miracle-filled tales, one must stop to wonder how — if what
Adda-Guppi had recorded was true — she managed to com-
municate with a deity that by her own statement was no
longer in the temple or in the city — gone and ascended to
heaven, in fact.

The first part, that of Adda-Guppi addressing her god, is
easy: she prayed, addressing her prayers to him. Prayer as a
way of laying before the deity one's fears and worries, asking
for health or good fortune or long life, even seeking guidance
for the right choices between alternatives, is still with us.
From the time when writing began in Sumer, prayers and
appeals to the gods were recorded. Indeed, prayer as a means
of communicating with one's deity probably preceded the
written word and, according to the Bible, began when the
first humans became Homo sapiens: It was when Enosh
("Homo sapiens Man"), the grandson of Adam and Eve,
was born, "that it was begun to call the name of God" (Gen-
esis 4:26).

Touching the hem of the god's robe, prostrating herself,
with great humility Adda-Guppi prayed to Sin. She did so
day after day, until he heard her prayers and responded.

Now comes the more tricky part — how did Sin respond,
how could his words or message reach the High Priestess?

268 THE COSMIC CODE

The inscription itself provides the answer: the god's response
came to her in a dream. As she passed out, perhaps in a
trancelike sleep, the god appeared to her in a dream:

In the dream

Sin, lord of the gods.

laid his two hands on me.

He spoke to me, thus:

"On account of you

the gods will return to inhabit Harran.

I will entrust your son, Nabuna 'id,

with the divine residences in Harran.

He shall rebuild the Ehulhul,

shall perfect its structure;

he will restore Harran and make her

more perfect than it was before."

Such a manner of communication, directed from a deity
to a human, was far from being unusual; indeed, it was the
one mostly employed. Throughout the ancient world kings
and priests, patriarchs and prophets received the divine word
through the medium of dreams. They could be oracle dreams
or omen ones, sometimes with words only heard, sometimes
including visions. In fact, the Bible itself quotes Yahweh
telling the sister and brother of Moses during the Exodus:
"If there be a prophet among you, I the Lord will make
myself known to him in a vision and will speak to him in a
dream. "

Nabuna'id also reported divine communications received
by means of dreams. But his inscriptions reported much
more: a unique event and an uncommon theophany. His two
stelae (referred to by scholars as H 2 A and H 2 B) are adorned
at their tops with a depiction of the king holding an unusual
staff and facing the symbols of three celestial bodies, the
planetary gods that he venerated (Fig. 92). The long inscrip-
tion below begins right off with the great miracle and its
uniqueness:

The God Who Returned from Heaven

269

Figure 92

This is the great miracle of Sin

that has by gods and goddesses

not happened to the land,

since days of old unknown;

That the people of the Land

had neither seen nor found written

on tablets since days of old:

That divine Sin,

Lord of gods and goddesses,

residing in the heavens,

has come down from the heavens —

in full view of Nabuna'id,

king of Babylon.

270 THE COSMIC CODE

The claim that this was a unique miracle was not unjus-
tified, for the event entailed both a return of a deity and a
theophany — two aspects of divine interaction with humans
that, as the inscription cautiously qualifies, were not un-
known in the Days of Old. Whether Nabuna'id (whom some
scholars have nicknamed "the first archaeologist" on ac-
count of his penchant for uncovering and digging up the
ruins of earlier sites) had qualified his statement just to be
on the safe side, or whether he was actually familiar, through
olden tablets, with such events that had indeed taken place
far away and long ago, we do not know; but the fact is mat
such events did happen.

Thus, in the turbulent times that ended with the demise of
the Sumerian empire circa 2000 B.C., the god Enlil, who was
away somewhere else, hurried back to Sumer when he was
notified that his city, Nippur, was in danger. According to
an inscription by the Sumerian king Shu-Sin, Enlil returned
"flying from horizon to horizon; from south to north he trav-
eled; through the skies, over Earth, he hurried."

That Return, however, was sudden, unannounced, and not
part of a theophany.

Some five hundred years later — still almost a thousand
years before the return and theophany by Sin — the greatest
theophany on record took place in the Sinai peninsula, during
the Israelite Exodus from Egypt. Notified in advance and told
how to prepare for the event, the Children of Israel — all
600,000 of them — witnessed the Lord descending upon
Mount Sinai. The Bible stresses that it was done "in full
sight of all the people" (Exodus 19:11). But that great the-
ophany was not a return.

Such divine comings and goings, including the ascent and
descent of Sin to and from the heavens, imply that the Great
Anunnaki possessed the required flying vehicles — and in-
deed they did. Yahweh landed on Mount Sinai in an object
that the Bible called Kabod that had the appearance of a
"devouring fire" (Exodus 24:11); the Prophet Ezekiel de-
scribed the Kabod (usually translated "glory" but which lit-
erally means "the heavy thing") as a luminous and radiating

The God Who Returned from Heaven 271

vehicle equipped with wheels within wheels. He might have
had in mind something comparable to the circular chariot in
which the Assyrian god Ashur was depicted (Fig. 85). Nin-
urta possessed the Imdugud, the "Divine Black Bird"; and
Marduk had a special housing built in his sacred precinct in
Babylon for his "Supreme Traveler"; it was probably the
same vehicle that the Egyptian called the Celestial Boat of
Ra.

What about Sin and his celestial comings and goings?

That he indeed possessed such a flying vehicle — an essen-
tial requirement for me heavenward departure and return re-
ported in the Harran inscriptions — is attested by many hymns
to him. A Sumerian one, describing Sin flying over his be-
loved city Ur, even referred to the god's Boat of Heaven as
his "glory":

Father Nannar, Lord of Ur

Whose glory is the sacred Boat of Heaven ...

When in the Boat of Heaven thou ascendeth,

thou art glorious.

Enlil hath adorned thy hand with a scepter.

everlasting when over Ur

in the Sacred Boat thou mountest.

While no depiction of the Moon god's "Boat of Heaven"
has so far been identified, a possible depiction does exist.
Lying astride a major route linking East and West across the
Jordan River was Jericho, one of the oldest known cities.
The Bible (and other ancient texts) refer to it as the City of
the Moon god — which is what the biblical name, Yeriho,
means. It was there mat me Prophet Elijah (9th century B.C.)
was told by the biblical God to go across the Jordan River
to be taken up, heavenward, in a fiery chariot. It was, as
described in 2 Kings chapter 2, not a chance event, but a
prearranged appointment. Starting his final journey from a
place called Gilgal, the Prophet was accompanied by his aide
Elisha and a group of disciples. And when they reached Jer-
icho, the disciples inquired of Elisha: "Do you know that

272 THE COSMIC CODE

the Lord will take your master away today?" And Elisha,
acknowledging that, admonished them to keep quiet.

When they reached the Jordan River, Elijah insisted that
me others stay behind. Fifty of the disciples advanced to the
river's edge and stopped; but Elisha would not depart. So
"Elijah took his mantle and, rolling it up, struck the water,
and it divided to the right and left, and the two of them
crossed over on dry land." Then, on the other side of the
Jordan,

A fiery chariot with fiery horses

suddenly appeared

and separated them one from the other;

and Elijah went up to heaven

in a whirlwind

In the 1920s an archaeological expedition sent by the Vat-
ican began excavations at a site in Jordan called Tell Ghas-
sul, "Mound of the Messenger." Its antiquity extended back
millennia, and some of the oldest dwellings in the ancient
Near East were unearthed mere. On some of me collapsed
walls the archaeologists discovered beautiful and unusual
murals painted in a variety of colors. One depicted a "star"
that looked more like a compass pointing to the major car-
dinal points and their subdivisions; another showed a seated
deity receiving a ritual procession. Other murals depicted
black bulbous objects with eyelike openings and extended
legs (Fig. 93); the latter could well have been the kind of
"fiery chariot" that carried Elijah heavenward. Indeed, the
place could well have been the very site of Elijah's ascent:
standing there, atop the mound, one can see the Jordan River
not far away and beyond it, shimmering in the distance, the
city of Jericho.

According to Jewish tradition, the Prophet Elijah will re-
turn someday to announce the Messianic Time.

That Adda-Guppi and her son Nabuna'id thought that such
a time had indeed arrived, signaled and signified by the Re-

The God Who Returned from Heaven 273

Figure 93

turn of the Moon god, is evident. They expected their Mes-
sianic Time to usher in an era of peace and prosperity, a new
era that would begin with the rebuilding and rededication of
the Temple of Harran.

That similar prophetic visions had taken place at about the
same lime regarding the God and the Temple of Jerusalem
is, on the other hand, hardly realized. But that, in fact, was
the subject of the prophecies of Ezekiel — that began "when
the heavens opened" and he saw the radiating celestial char-
iot coming in a whirlwind.

The chronology provided in the Harran inscriptions, as
verified by scholars from Assyrian and Babylonian annals,
indicates that Adda-Guppi was born circa 650 B.C.; mat Sin
departed from his temple in Harran in 610 B.C. — and re-
turned in 556 B.C. That was the exact same period when
Ezekiel, who had been a priest in Jerusalem, was called to
prophecy when he was among the Judean exiles in northern
Mesopotamia. We are provided by him with an exact date:
It was on the fifth day of the fourth month in me fifth year
of the exile of the Judean king Jeho'iachin, "when I was
among the exiles on the banks of the river Khebar that the
heavens opened up and I saw divine visions," Ezekiel wrote
right at the beginning of his prophecies. The time was 592
B.C.!

274 THE COSMIC CODE

The Khobar (or Khabur, as it is now known) River is one
of the tributaries of the great Euphrates River that begins its
flow in the mountains of today's eastern Turkey. Not too far
to the east of the Khabur River is another important tributary
of the Euphrates, the River Balikh; and it is on the shores of
the Balikh that Harran has been situated for millennia.

Ezekiel found himself so far away from Jerusalem, on the
banks of a river in Upper Mesopotamia, at the edge of Hittite
territory ("Hattiland" in cuneiform records), because he was
one of several thousand noblemen, priests, and other leaders
of Judea who were captured and taken into exile by Nebu-
chadnezzar, the Babylonian king who overran Jerusalem in
597 B.C.

Those tragic events are detailed in the second book of
Kings, mainly 24:8-12. Remarkably, a Babylonian clay tab-
let (part of the series known as The Babylonian Chronicles)
recorded the very same events, with matching dates.

Remarkably too, this Babylonian expedition — like the ear-
lier one by Esarhaddon — was also launched from a starting
point near Harran!

The Babylonian inscription details the capture of Jerusa-
lem, the seizing of its king, his replacement on the throne of
Judea by another king of Nebuchadnezzar's choice, and the
exiling — "sending off to Babylon" — of the captured king
and the land's leaders. It was thus that the priest Ezekiel
found himself on the banks of the Khabur River in the prov-
ince of Harran.

For a while — apparently for the first five years — the exiles
believed that the calamities that had befallen their city and
temple and themselves were a temporary setback. Though
the Judean king Jeho'iachin was held in captivity, he was
alive. Though the Temple's treasures were carried off to Bab-
ylon as booty, the Temple was still intact; and me majority
of the people still remained in their land. The exiles, keeping
in touch with Jerusalem by messengers, had high hopes mat
one day Jeho'iachin would be reinstated and the Temple re-
stored to its sacred glory.

But no sooner had Ezekiel been called to prophecy, in the

The God Who Returned from Heaven 275

fifth year of exile (592 B.C.)- than the Lord God instructed
him to announce to the people that the exile and the sacking
of Jerusalem and its Temple were not the end of the ordeal.
It was only meant as a warning to the people to mend their
ways — behave with justice toward each other, and worship
Yahweh according to the Commandments. But, said Yahweh
to Ezekiel, the people did not mend their ways; rather, they
turned to the worship of "alien gods." Therefore, said the
Lord God, Jerusalem shall be attacked again, and this time
it shall be totally destroyed, temple and all.

The instrument of his wrath, Yahweh said, would again
be the king of Babylon. It is an established and known his-
torical fact that in 587 B.C. Nebuchadnezzar, distrusting the
king he himself had set on the Judean throne, again besieged
Jerusalem. This time, in 586 B.C., the captured city was
burned and left in ruins; so was the Temple of Yahweh that
Solomon had built half a millennium earlier.

This much is indeed known. But what is hardly known is
the reason why the warning was not heeded by the people
and their remaining leaders in Jerusalem. It was their belief
that "Yahweh has left the Earth!"

Accorded what would these days he deemed "remote vi-
sion," Ezekiel was shown first the Elders of Jerusalem be-
hind their closed doors, then taken on a visionary tour of the
city's streets. There was a complete breakdown of justice and
religious observances, for the word that got out was

Yahweh sees us no more —
Yahweh has left the Earth!

It was in 610 B.C., according to the Harran inscriptions,
that "Sin, lord of gods, became angry with his city and his
temple and went up to heaven." It was in 597 B.C. — just
over a decade later — that Yahweh became angry with Jeru-
salem his city and its people, and let the uncircumcised Neb-

276 THE COSMIC CODE

uchadnezzar — a king by the grace of Marduk — enter, loot

and destroy the Temple of Yahweh.

And the people cried out: "God has left the Earth!"
And they knew not when, or if ever, He would return.

EPILOGUE

His mother's great expectations for Nabuna'id, as a reuniter
of Sumer and Akkad and restorer of the glorious Olden Days,
did not prepare the new king for the turmoil that he soon
faced. He might have expected military challenges; he did
not anticipate the religious fervor with which his domains
were seized.

No sooner was he on the royal throne in Babylon, under
a deal between his mother and Sin, than he realized that
Marduk — once removed and since returned to Babylon — had
to be appeased and given his due. In a series of true or pre-
tended omen-dreams, Nabuna'id reported obtaining the
blessing of Marduk (and Nabu) not only to his kingship, but
also to the promised rebuilding of Sin's temple in Harran.

To leave no doubt about the importance of those dream-
messages, the king reported that Marduk specifically inquired
of him whether he had seen the "Great Star, the planet of
Marduk" — a direct reference to Nibiru — and what other
planets were in conjunction with it. When the king reported
that they were the "god 30" (the Moon, Sin's celestial coun-
terpart) and the "god 15" (Ishtarand her counterpart Venus),
he was told: "There are no evil portents in the conjunction."

But neither the people of Harran nor the people of Babylon
were happy with this "co-regnum" of the gods, nor were
the followers of Ishtar "and the other gods." Sin, whose
temple in Harran was eventually restored, demanded that his
great temple in Ur should also become again a center of

277

278 THE COSMIC CODE

worship, lshtar complained that her golden cela in Uruk (Er-
ech) must be reconstructed and that she be given again a
chariot drawn by seven lions. And, as one reads between the
lines of the king's inscription, he was getting fed up with
that tug and pull by multiple gods and their priesthoods.

In a text titled by scholars Nabuna'id and the Clergy of
Babylon (on a tablet now in the British Museum), the priests
of Marduk presented a charge sheet, a list of accusations
against Nabuna'id; they ran from civil mailers ("law and
order are not promulgated by him") through economic ne-
glect ("the farmers are corrupted," "the trader's roads are
blocked") and unsuccessful wars ("the nobles are killed in
war") to the most serious charges: religious sacrilege —

He made an image of a god

which nobody had seen before in the land;

He placed it in the temple,

raised it upon a pedestal...

With lapis lazuli he adorned it,

crowned it with a tiara...

It was a statue of a strange deity — never seen before, the
priests stressed — with "hair reaching down to the pedestal."
It was so unusual or unseemly that not even Enki and Nin-
mah could have conceived it, so strange that "not even the
learned Adapa knows his name." To make matters worse,
two unusual beasts were sculpted as its guardians: one rep-
resenting the Deluge-Demon and the other a Wild Bull. To
add insult to sacrilege, the king placed this abomination in
the Esagil temple of Marduk, and announced that the Akitu
(New Year) festival, which was central to the equating of
Marduk with the celestial Nibiru, would no longer be cele-
brated.

The priests announced for all to hear that "the protective
deity of Nabuna'id became hostile to him," that "the former
favorite of the gods was now fated to misfortune." And so
Nabuna'id announced that he was leaving Babylon "on an
expedition to a distant region." He named his son Bel-shar-

Epilogue 279

uzur ("Bel/Marduk protects the king" — the Belshazzar of
the Book of Daniel) as regent.

His destination was Arabia, and his entourage included, as
the various inscriptions attest, Jews from among the Judean
exiles. His principal base was at a city called Teima (a name
encountered in the Bible) and he established six settlements
for his followers; five of mem were listed, a thousand years
later, by Islamic sources as Jewish towns. Some believe that
Nabuna'id was seeking the seclusion of the desert to contem-
plate monotheism; a text fragment discovered among the
Dead Sea scrolls in Qumran reports that Nabuna'id was smit-
ten with an "unpleasant skin disease" in Teima. and was
cured only after "a Jew told him to give honor to the God
Most High." The bulk of the evidence suggests, however,
that he was propagating the worship of Sin, the Moon god
symbolized by the crescent — a symbol adopted in time by
the Arabian worshipers of Allah.

Whatever the religious beliefs Nabuna'id was captivated
by, they were anathema to the priests in Babylon. And so,
when the Achaemenid rulers of Persia absorbed the kingdom
of Medea and expanded into Mesopotamia, Cyrus the king
was welcomed in Babylon not as a conqueror but as a lib-
erator. Wisely, he rushed to the Esagil temple as soon as he
entered the city and "held the hands of Marduk by both
hands."

The year was 539 B.C.; it marked the prophesied end of
Babylonian independent existence.

One of his first acts was to issue a proclamation permitting
the Jewish exiles to return to Judea and rebuild the Temple
in Jerusalem. The edict, recorded on the Cylinder of Cyrus
that is now kept in the British Museum, corroborates the
Biblical report, according to which Cyrus "was charged to
do so by Yahweh, the God of Heaven."

The rebuilding of the Temple, under the leadership of Ezra
and Nehemiah, was completed in 516 B.C. — seventy years
after its destruction, as had been prophesied by Jeremiah.

280 THE COSMIC CODE

The story of Babylon's end is told in the Bible in one of
its most enigmatic books, the Book of Daniel. Introducing
Daniel as one of the Judean exiles taken into Babylonian
captivity, it relates how he was selected, with three other
friends, to serve in the court of Nebuchadnezzar and how (as
Joseph in Egypt) he was elevated to high office after solving
the king's omen-dreams about future events.

The book then moves to events at the time of Belshazzar,
when, during a great banquet, a hand floating by itself ap-
peared and wrote on the wall MENE MENE TEKEL
UPHARSIN. Not one of the king's seers and wizards could
decipher the inscription. As a last resort, Daniel — now long
retired — was called in. And Daniel explained the meaning to
the Babylonian king: God has numbered the days of your
kingdom; you have been weighed and found wanting; your
kingdom will come to an end, divided between the Medes
and the Persians.

After that Daniel himself began to have omen-dreams and
see visions of the future in which the "Ancient of Days"
and his archangels played key roles. Baffled by this own
dreams and visions, Daniel asked the angels for explanations.
In each instance they turned out to be predictions of future
events that went beyond the fall of Babylon, even beyond
the fulfillment of the seventy-year prophecy of the rebuilding
of the Temple. The rise and fall of the Persian Empire was
predicted, the coming of the Greeks under Alexander, the
split of his domains after his death, and what followed.

Though many modern scholars — but not Jewish sages or
the Fathers of the Christian Church — take those prophecies
(only accurate in part) as hindsight, indicating a much later
author (or even several authors), the central point of the
dreams, visions, and omens experienced by Daniel is a pre-
occupation with the question: When? When will be the final
kingdom, the only one that will survive and last?

It will be one that only the followers of the God Most
High, the "Ancient of Days," will live to see (even the dead
among them, who will rise). But over and over again, Daniel
kept asking the angels: When?

Epilogue 281

In one instance the angel responded that a phase in the
future events, a time when an unholy king shall try to
"change the times and the laws," will last "a time, times,
and half a time;" only after that will "the kingdoms under
heaven be given to the people, the holy ones of the Most
High."

Another time the revealing angel said: "Seventy weeks of
years have been decreed for your people and your city until
the measure of transgression is filled and prophetic vision
ratified."

One more time a divine emissary was asked by Daniel:
"How long until the end of these awful things?" He got
again the enigmatic answer: The fulfillment of all the proph-
esied things shall come after "a time, times and half a time."

"I heard and did not understand," Daniel wrote. "So I
said, my Lord, what will be the outcome of these things?"
Speaking still in codes, the divine being answered, "From
the time the regular offering is abolished and an appalling
abomination is set up it will be a thousand and two hundred
and ninety days. Happy is the one who waits and reaches
one thousand three hundred and thirty-five days."

As Daniel stood puzzled, the Angel of God added:

You, Daniel, shall rest and arise

to your destiny at the End of Days...

But keep the words secret,

and seal the book until the End of Time.

At the End of Time, when the nations of Earth shall gather
in Jerusalem, they shall all speak "in a clear language,"
stated the Prophet Zephaniah (whose very name meant "By
Yahweh Encoded") — there will no longer be a need for con-
founded languages and letters to be read backward and hid-
den encodings.

And, as Daniel, we are still asking: When?